ID: 959523919

View in Genome Browser
Species Human (GRCh38)
Location 3:107354540-107354562
Sequence TATCATTCTTTAGATTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959523917_959523919 0 Left 959523917 3:107354517-107354539 CCTTCGAACATGTAACCTCAGTT No data
Right 959523919 3:107354540-107354562 TATCATTCTTTAGATTTAGATGG No data
959523915_959523919 30 Left 959523915 3:107354487-107354509 CCTTATATTTCTTCCAAGACAGT No data
Right 959523919 3:107354540-107354562 TATCATTCTTTAGATTTAGATGG No data
959523916_959523919 17 Left 959523916 3:107354500-107354522 CCAAGACAGTTCAAGAACCTTCG No data
Right 959523919 3:107354540-107354562 TATCATTCTTTAGATTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959523919 Original CRISPR TATCATTCTTTAGATTTAGA TGG Intergenic
No off target data available for this crispr