ID: 959524678

View in Genome Browser
Species Human (GRCh38)
Location 3:107363425-107363447
Sequence AAGCACATCTATGGGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959524678_959524682 1 Left 959524678 3:107363425-107363447 CCTTCTGACCCATAGATGTGCTT No data
Right 959524682 3:107363449-107363471 TTCTAATATTGGAATTAGAATGG No data
959524678_959524681 -10 Left 959524678 3:107363425-107363447 CCTTCTGACCCATAGATGTGCTT No data
Right 959524681 3:107363438-107363460 AGATGTGCTTTTTCTAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959524678 Original CRISPR AAGCACATCTATGGGTCAGA AGG (reversed) Intergenic
No off target data available for this crispr