ID: 959527417

View in Genome Browser
Species Human (GRCh38)
Location 3:107392754-107392776
Sequence ATAACTAGCCAGAAAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959527417_959527422 20 Left 959527417 3:107392754-107392776 CCAGTTACTTTCTGGCTAGTTAT No data
Right 959527422 3:107392797-107392819 CCTCAATCCCATTTTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959527417 Original CRISPR ATAACTAGCCAGAAAGTAAC TGG (reversed) Intergenic
No off target data available for this crispr