ID: 959527419

View in Genome Browser
Species Human (GRCh38)
Location 3:107392784-107392806
Sequence GGGATTGAGGCAAGGAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959527419_959527422 -10 Left 959527419 3:107392784-107392806 CCACTTTTCCTTGCCTCAATCCC No data
Right 959527422 3:107392797-107392819 CCTCAATCCCATTTTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959527419 Original CRISPR GGGATTGAGGCAAGGAAAAG TGG (reversed) Intergenic