ID: 959527422

View in Genome Browser
Species Human (GRCh38)
Location 3:107392797-107392819
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959527418_959527422 -9 Left 959527418 3:107392783-107392805 CCCACTTTTCCTTGCCTCAATCC No data
Right 959527422 3:107392797-107392819 CCTCAATCCCATTTTTCACATGG No data
959527419_959527422 -10 Left 959527419 3:107392784-107392806 CCACTTTTCCTTGCCTCAATCCC No data
Right 959527422 3:107392797-107392819 CCTCAATCCCATTTTTCACATGG No data
959527417_959527422 20 Left 959527417 3:107392754-107392776 CCAGTTACTTTCTGGCTAGTTAT No data
Right 959527422 3:107392797-107392819 CCTCAATCCCATTTTTCACATGG No data
959527415_959527422 30 Left 959527415 3:107392744-107392766 CCAGACTACTCCAGTTACTTTCT No data
Right 959527422 3:107392797-107392819 CCTCAATCCCATTTTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type