ID: 959528393

View in Genome Browser
Species Human (GRCh38)
Location 3:107403352-107403374
Sequence TACAATGAACTGCCATAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959528393_959528394 2 Left 959528393 3:107403352-107403374 CCAGTCTATGGCAGTTCATTGTA No data
Right 959528394 3:107403377-107403399 AGCCCAAACAGACTAAGAAAAGG No data
959528393_959528397 4 Left 959528393 3:107403352-107403374 CCAGTCTATGGCAGTTCATTGTA No data
Right 959528397 3:107403379-107403401 CCCAAACAGACTAAGAAAAGGGG No data
959528393_959528399 11 Left 959528393 3:107403352-107403374 CCAGTCTATGGCAGTTCATTGTA No data
Right 959528399 3:107403386-107403408 AGACTAAGAAAAGGGGAGAGTGG No data
959528393_959528395 3 Left 959528393 3:107403352-107403374 CCAGTCTATGGCAGTTCATTGTA No data
Right 959528395 3:107403378-107403400 GCCCAAACAGACTAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959528393 Original CRISPR TACAATGAACTGCCATAGAC TGG (reversed) Intergenic
No off target data available for this crispr