ID: 959530478

View in Genome Browser
Species Human (GRCh38)
Location 3:107430243-107430265
Sequence TCCAGCATGCTCTCCTACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959530478_959530492 30 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530492 3:107430296-107430318 AGGCGGGGAGTGGGGAAGGGGGG No data
959530478_959530481 10 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530481 3:107430276-107430298 CTCTGACACTGCTTCGGTGAAGG No data
959530478_959530488 26 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530488 3:107430292-107430314 GTGAAGGCGGGGAGTGGGGAAGG No data
959530478_959530483 14 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530483 3:107430280-107430302 GACACTGCTTCGGTGAAGGCGGG No data
959530478_959530480 4 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530480 3:107430270-107430292 AGAGGACTCTGACACTGCTTCGG No data
959530478_959530485 20 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530485 3:107430286-107430308 GCTTCGGTGAAGGCGGGGAGTGG No data
959530478_959530486 21 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530486 3:107430287-107430309 CTTCGGTGAAGGCGGGGAGTGGG No data
959530478_959530487 22 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530487 3:107430288-107430310 TTCGGTGAAGGCGGGGAGTGGGG No data
959530478_959530482 13 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530482 3:107430279-107430301 TGACACTGCTTCGGTGAAGGCGG No data
959530478_959530484 15 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530484 3:107430281-107430303 ACACTGCTTCGGTGAAGGCGGGG No data
959530478_959530490 28 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530490 3:107430294-107430316 GAAGGCGGGGAGTGGGGAAGGGG No data
959530478_959530489 27 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530489 3:107430293-107430315 TGAAGGCGGGGAGTGGGGAAGGG No data
959530478_959530491 29 Left 959530478 3:107430243-107430265 CCATTGTAGGAGAGCATGCTGGA No data
Right 959530491 3:107430295-107430317 AAGGCGGGGAGTGGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959530478 Original CRISPR TCCAGCATGCTCTCCTACAA TGG (reversed) Intergenic