ID: 959530734

View in Genome Browser
Species Human (GRCh38)
Location 3:107431541-107431563
Sequence CGCCGCCGCCGCCGGGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959530724_959530734 10 Left 959530724 3:107431508-107431530 CCCAGGCGGAAGGCGCGGCGGGG No data
Right 959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG No data
959530726_959530734 9 Left 959530726 3:107431509-107431531 CCAGGCGGAAGGCGCGGCGGGGC No data
Right 959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959530734 Original CRISPR CGCCGCCGCCGCCGGGGCTC GGG Intergenic
No off target data available for this crispr