ID: 959530736

View in Genome Browser
Species Human (GRCh38)
Location 3:107431544-107431566
Sequence CGCCGCCGCCGGGGCTCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959530724_959530736 13 Left 959530724 3:107431508-107431530 CCCAGGCGGAAGGCGCGGCGGGG No data
Right 959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG No data
959530728_959530736 -10 Left 959530728 3:107431531-107431553 CCACGGTCACCGCCGCCGCCGCC No data
Right 959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG No data
959530726_959530736 12 Left 959530726 3:107431509-107431531 CCAGGCGGAAGGCGCGGCGGGGC No data
Right 959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959530736 Original CRISPR CGCCGCCGCCGGGGCTCGGG CGG Intergenic
No off target data available for this crispr