ID: 959530738

View in Genome Browser
Species Human (GRCh38)
Location 3:107431549-107431571
Sequence CGCTTCCGCCCGAGCCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959530738_959530754 22 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530754 3:107431594-107431616 CCGCGCCCCCGCAAGGCCCAGGG No data
959530738_959530745 -10 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530745 3:107431562-107431584 GGCGGAAGCGCGGGCTCCGGGGG No data
959530738_959530748 -5 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530748 3:107431567-107431589 AAGCGCGGGCTCCGGGGGGAGGG No data
959530738_959530752 21 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530752 3:107431593-107431615 GCCGCGCCCCCGCAAGGCCCAGG No data
959530738_959530758 29 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530758 3:107431601-107431623 CCCGCAAGGCCCAGGGATCCCGG No data
959530738_959530749 -4 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530749 3:107431568-107431590 AGCGCGGGCTCCGGGGGGAGGGG No data
959530738_959530751 15 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530751 3:107431587-107431609 GGGGCTGCCGCGCCCCCGCAAGG No data
959530738_959530747 -6 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530747 3:107431566-107431588 GAAGCGCGGGCTCCGGGGGGAGG No data
959530738_959530746 -9 Left 959530738 3:107431549-107431571 CCGCCGGGGCTCGGGCGGAAGCG No data
Right 959530746 3:107431563-107431585 GCGGAAGCGCGGGCTCCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959530738 Original CRISPR CGCTTCCGCCCGAGCCCCGG CGG (reversed) Intergenic
No off target data available for this crispr