ID: 959537403

View in Genome Browser
Species Human (GRCh38)
Location 3:107501750-107501772
Sequence AAACTGGTTTACAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959537399_959537403 9 Left 959537399 3:107501718-107501740 CCCTAGAACTTAAAGTATAATAA 0: 4964
1: 17988
2: 9381
3: 3577
4: 1832
Right 959537403 3:107501750-107501772 AAACTGGTTTACAGGACAGAAGG No data
959537400_959537403 8 Left 959537400 3:107501719-107501741 CCTAGAACTTAAAGTATAATAAA 0: 4172
1: 11838
2: 19568
3: 8336
4: 4491
Right 959537403 3:107501750-107501772 AAACTGGTTTACAGGACAGAAGG No data
959537398_959537403 30 Left 959537398 3:107501697-107501719 CCTGCGCATTGTGCACATGTACC 0: 64
1: 9044
2: 15793
3: 10310
4: 7952
Right 959537403 3:107501750-107501772 AAACTGGTTTACAGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959537403 Original CRISPR AAACTGGTTTACAGGACAGA AGG Intergenic
No off target data available for this crispr