ID: 959539838

View in Genome Browser
Species Human (GRCh38)
Location 3:107525153-107525175
Sequence CCGCGCGGGGACGTCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959539838_959539846 -8 Left 959539838 3:107525153-107525175 CCGGCGCCGACGTCCCCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 165
Right 959539846 3:107525168-107525190 CCGCGCGGCCACCCCGGGTCCGG 0: 1
1: 0
2: 0
3: 12
4: 158
959539838_959539856 27 Left 959539838 3:107525153-107525175 CCGGCGCCGACGTCCCCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 165
Right 959539856 3:107525203-107525225 TGCGCCGCGCGGTCCAAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 50
959539838_959539854 16 Left 959539838 3:107525153-107525175 CCGGCGCCGACGTCCCCGCGCGG 0: 1
1: 0
2: 1
3: 15
4: 165
Right 959539854 3:107525192-107525214 CCCACGCGCTCTGCGCCGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959539838 Original CRISPR CCGCGCGGGGACGTCGGCGC CGG (reversed) Intronic
900155350 1:1201524-1201546 CGGCGCGGAAACGTCAGCGCGGG - Intergenic
900162782 1:1232251-1232273 CCGCGCCGGGCCGGCGGCCCAGG - Exonic
900334322 1:2154069-2154091 CCCCGCAGGGACGTCGGCGTTGG - Intronic
900589752 1:3454399-3454421 CCTCGAGGGGGCGTGGGCGCGGG + Intergenic
903555065 1:24187255-24187277 CCGGGCGGGGACGCCGCGGCAGG - Exonic
903813151 1:26045988-26046010 CCTCGCGGGGCCCTCGGGGCAGG - Exonic
906263157 1:44407913-44407935 CCGCGCGGGGCCCGCGGGGCAGG - Intronic
906961418 1:50421482-50421504 CGGCGCGGCGACGGCGGCGGCGG - Exonic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
918064222 1:181088871-181088893 CTGCACAGGGCCGTCGGCGCCGG - Exonic
923007920 1:230067082-230067104 CCGCGCGGCGCCGCCGGCCCGGG + Intronic
923372565 1:233327998-233328020 CTGCGCGGGGAAGGCGGAGCGGG - Exonic
1071278853 10:84081392-84081414 CAGCGGTGGGACGTAGGCGCTGG - Intergenic
1072719365 10:97771276-97771298 GCGCGCGGGGACGGCGGCGGCGG + Intronic
1073048713 10:100654764-100654786 TCGCGCGGCGACGGCGGCGGCGG - Intergenic
1074819074 10:117165763-117165785 CCGCGCGTTGCCGTCGGTGCGGG - Intergenic
1076374263 10:129972936-129972958 CCGCGAGGTGTCGGCGGCGCCGG + Intergenic
1077010089 11:375786-375808 CCGCGCGGGGGCGAGGGCGGGGG + Intronic
1077048457 11:556149-556171 CCGGGCCGGGCCGTCGGGGCCGG + Intronic
1077103847 11:833447-833469 CCGGGCGGGGTCGGCGGCGGCGG + Intronic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077107894 11:849811-849833 GCGCGCGGGGTCGGGGGCGCGGG + Intronic
1081969092 11:47186114-47186136 CCGCCCGGGGGAGGCGGCGCCGG - Intronic
1083436338 11:62646216-62646238 GTGCGCGGGGTCGTCGGGGCGGG - Intronic
1084546755 11:69818613-69818635 CCCCGCGGGGGAGGCGGCGCCGG - Intronic
1089529924 11:119121176-119121198 CCGAGCGGGGCCGACAGCGCTGG + Intergenic
1090832415 11:130428484-130428506 CGGCTCGGGGGCGGCGGCGCGGG - Exonic
1092159991 12:6310795-6310817 GCGGGCGGGGAGGGCGGCGCAGG + Intronic
1092229071 12:6766821-6766843 CCGCGCGGGGCCGTCGGGGGCGG - Intronic
1092246762 12:6868118-6868140 CGGCGCGGGGACGCGGACGCCGG - Intronic
1098255340 12:68610752-68610774 GCGCGCCGGGTCCTCGGCGCCGG - Intergenic
1100444817 12:94650581-94650603 CCCCGCGGCGGCGGCGGCGCAGG - Intergenic
1102278156 12:111598704-111598726 CGGGGCGGGGACGGCGGCGCGGG + Intronic
1102453333 12:113057001-113057023 CGGCTCGGGGACGTCTGGGCTGG + Intronic
1103485362 12:121279251-121279273 CCGGGCAGGGACGTCGGCGCTGG + Intronic
1106242033 13:27920353-27920375 CACCGCGGGGTCGTCGGCGAGGG - Exonic
1106516955 13:30464706-30464728 CCTCGCGGCGGCGGCGGCGCAGG - Intronic
1106602561 13:31200226-31200248 CGGCGCGGGGAGGGAGGCGCAGG + Intronic
1107935225 13:45340845-45340867 CCGCGTGCGGCCGCCGGCGCGGG - Intronic
1113656918 13:112073114-112073136 CCGCGCGCGGGCCTCGGCGGGGG - Intergenic
1113743653 13:112727816-112727838 CAGCTCGGGGACTCCGGCGCTGG + Intronic
1113846342 13:113393939-113393961 ACGTGCGGGGACCTCGGCGCTGG - Intergenic
1113874217 13:113584674-113584696 CGGCGCGGTGACGTGGGCGGCGG - Intergenic
1117974150 14:61281153-61281175 CCGCGCGGGGACCGACGCGCGGG + Exonic
1118404807 14:65412732-65412754 TCGCGCGCGCACGCCGGCGCTGG + Intronic
1119003980 14:70907798-70907820 CGGGGCGGGGACGGCGGCGGCGG + Exonic
1120953041 14:90060480-90060502 CCGCGCGGGGCTGTGTGCGCGGG + Intergenic
1121074928 14:91060244-91060266 CCGCGCGGGGCTGGGGGCGCGGG - Intronic
1122651974 14:103231178-103231200 CGGCCCGGGGATGACGGCGCAGG + Intergenic
1124014283 15:25862935-25862957 GCGAGCGGCGACGGCGGCGCGGG - Exonic
1124696898 15:31870824-31870846 CGGCGCGCGCACGTCCGCGCGGG - Intergenic
1125535873 15:40441079-40441101 CCGGGCGGGGCCGTCGGGGGGGG - Intronic
1126786216 15:52179693-52179715 CCGGGCGGGGACGGCGGGGGCGG - Intronic
1126823667 15:52528925-52528947 CCGGGCGGGGAGGGCCGCGCGGG + Exonic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128365772 15:67001100-67001122 CGGCGGGGGGACATAGGCGCTGG + Intergenic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1130994238 15:88895229-88895251 CGGCGCGGGGATGCGGGCGCCGG - Intronic
1131257350 15:90871465-90871487 CCGCGCGGGGCCGGACGCGCTGG + Intronic
1132580084 16:680695-680717 CCGCGCGGGGAGGGCGGCGGCGG + Intronic
1132583070 16:694152-694174 CCGCGCTGGGCCGGGGGCGCGGG + Exonic
1133040882 16:3059245-3059267 CCGCGCAGGGGCGGCGGCGGCGG + Exonic
1134134051 16:11668346-11668368 CCGCGCTGGGACGGCGGGGCGGG - Intergenic
1136458361 16:30395153-30395175 CCGGCCGGGGAGGTCGGCGCGGG + Exonic
1140469240 16:75205376-75205398 CCCCGCGGGGAAGTCGTCGTCGG + Exonic
1140472544 16:75223563-75223585 CCCCGCGGGGAAGTCGTCGTCGG - Exonic
1141418947 16:83899279-83899301 CCGCGCGGTGCCGCCGACGCCGG + Exonic
1141957688 16:87383551-87383573 CAGCGCGGGGGCGGCGGCGAGGG + Exonic
1142958302 17:3535625-3535647 GTGCGCGTTGACGTCGGCGCCGG + Exonic
1144527213 17:16000061-16000083 CCGGGCGGGGACAGGGGCGCGGG + Intronic
1145031391 17:19507595-19507617 GAGCGAGGGGACGTCGGGGCGGG - Intronic
1148356442 17:46978846-46978868 CCCCGCGGGGACCCCGTCGCTGG + Exonic
1148796517 17:50199784-50199806 GCCCTCGGGGACTTCGGCGCCGG + Exonic
1148854766 17:50572669-50572691 CTGCGCGGGGACGGGGGCGGTGG + Exonic
1151593211 17:75060585-75060607 CAGAGCGGGGAGGCCGGCGCCGG - Intronic
1152433102 17:80260504-80260526 CTGCGCGGGGCCGGCGGCGGCGG + Intergenic
1152552269 17:81035586-81035608 CCGAGCAGGGCCGTCGGAGCGGG - Intronic
1152596166 17:81238833-81238855 CAGCTCAGGGGCGTCGGCGCGGG + Intronic
1152677302 17:81648217-81648239 GCGCGCGGGGAGGACCGCGCTGG + Exonic
1155053239 18:22165748-22165770 CCGCCCGGGGACCCCGGCGCTGG + Intergenic
1158976859 18:62716959-62716981 CCGGGCGGGGCCGTCCGCGAGGG + Exonic
1160453357 18:78979813-78979835 CCGCGCGGCGCCGTCTCCGCCGG - Intergenic
1160745392 19:708990-709012 CGGCGCGGGGGCGGCGGCACCGG - Intergenic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160812871 19:1020542-1020564 CCGCCCGGGGACGTCCACCCGGG - Intronic
1160961866 19:1725716-1725738 CCGCGCGGGGGCGCATGCGCGGG + Intergenic
1160991920 19:1863620-1863642 CCGAGCGCGGGCGTCGGCGGCGG - Intergenic
1161333817 19:3700393-3700415 CCGCGCGCGGACGGCGGCGGGGG + Exonic
1161382158 19:3971111-3971133 GGGTGCGGTGACGTCGGCGCAGG - Intronic
1161400937 19:4066016-4066038 CCGCGGCGGGCTGTCGGCGCGGG + Intronic
1161494992 19:4581666-4581688 CCGCGCGCTGGCGTCGGCTCCGG + Intergenic
1163807037 19:19405775-19405797 CCGGGCGGTGACGCCGGCGCCGG + Intronic
1165058609 19:33194391-33194413 CGGCCCGGGGACGCCGGGGCCGG + Intronic
1166316845 19:41994110-41994132 CGGGGCGGGGACCTCGGGGCGGG + Exonic
1168103418 19:54153046-54153068 CCGAGGGGGGACGGCGGCGGTGG - Intronic
924987729 2:287607-287629 CCGCGCGGAGGCGGCGGGGCTGG - Exonic
927652343 2:24920201-24920223 CCGCGCGGCGCCGGCGGCTCCGG + Intergenic
929033667 2:37671695-37671717 CGGGGCGGGGCCGGCGGCGCGGG + Exonic
929604754 2:43226809-43226831 CCGGGCGGGGCCGGCGGCCCGGG + Intergenic
929647045 2:43637739-43637761 CCGCGCGGGTCCCTCGGCTCGGG - Intronic
932036422 2:68251832-68251854 CCGGGCGGGACCGGCGGCGCGGG + Intronic
934566840 2:95346221-95346243 CCGCGCGGAGTCGGCGGCGGGGG - Intronic
942314199 2:174682939-174682961 CGGCGGGGGGGCGGCGGCGCCGG - Intergenic
944614970 2:201451229-201451251 TCACGCGCGGACGTCGGAGCCGG - Intronic
1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG + Intronic
1169327249 20:4686366-4686388 TCGCGGGCGGAGGTCGGCGCGGG - Exonic
1170999103 20:21396155-21396177 CGGCGCGGGGACGGCGGCGGAGG + Exonic
1172793448 20:37521568-37521590 CAGCGCGAGGAGGACGGCGCAGG - Intronic
1173673000 20:44810700-44810722 GCGCGCGGGGAGGCAGGCGCCGG + Intergenic
1175847234 20:62065364-62065386 CCCCGCGGCGACGGCGGCGGCGG + Exonic
1176135707 20:63521146-63521168 CCGCGCGGCGAAGGCGGTGCCGG + Intronic
1176207221 20:63895508-63895530 GGGCGCGGGAAGGTCGGCGCCGG + Intronic
1176547646 21:8208541-8208563 CCGCGCGGTGCCGCCGGCGGCGG + Intergenic
1176550006 21:8216980-8217002 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1176566597 21:8391588-8391610 CCGCGCGGTGCCGCCGGCGGCGG + Intergenic
1176568932 21:8400014-8400036 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1176574472 21:8435775-8435797 CCGCGCGGTGCCGCCGGCGGCGG + Intergenic
1176576846 21:8444249-8444271 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1176611085 21:8987067-8987089 CCGCGCGGTGCCGCCGGCGGCGG + Intergenic
1176733667 21:10522455-10522477 CGGAGGGGGGACGTCGGCGTAGG + Intronic
1177431698 21:20998288-20998310 CCGGGCGGGGAGGGCGGCGGGGG - Intergenic
1179243858 21:39613135-39613157 GCGCGCGGGGGCGTGGGTGCCGG + Intronic
1180962034 22:19766496-19766518 CTGCCCGGGGCCGGCGGCGCCGG + Exonic
1181793123 22:25283084-25283106 CCGCTTGGGGACGGCGGCGTGGG - Intergenic
1183605962 22:38866833-38866855 CCGCGAGGGGACTTTGGGGCGGG + Exonic
1183961452 22:41413975-41413997 CTGCGCGGCGACGTCAGCGCGGG - Intergenic
1185037948 22:48489508-48489530 CCGCACGTGGAGGCCGGCGCGGG + Exonic
1185278751 22:49961035-49961057 ACGCGCGGGGCCGGCGGGGCCGG + Intronic
1185397551 22:50600658-50600680 CGGCGCGGGGAGGGCGGCGGGGG - Intronic
1203252520 22_KI270733v1_random:124826-124848 CCGCGCGGTGCCGCCGGCGGCGG + Intergenic
1203254896 22_KI270733v1_random:133306-133328 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1203260576 22_KI270733v1_random:169912-169934 CCGCGCGGTGCCGCCGGCGGCGG + Intergenic
1203262952 22_KI270733v1_random:178385-178407 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
952451785 3:33440146-33440168 CCGGGCGGGGCGGTCGGCGGCGG - Exonic
952942331 3:38454167-38454189 CTGCTCGGGGACGAAGGCGCAGG + Exonic
959539838 3:107525153-107525175 CCGCGCGGGGACGTCGGCGCCGG - Intronic
961067001 3:123884206-123884228 CCGCGCGGCGAAGGCGGCCCGGG + Intronic
966594205 3:181711785-181711807 CCCCGCGCGGCCGGCGGCGCGGG + Intergenic
968701208 4:2059100-2059122 ACGGGCGGGGGCGGCGGCGCGGG - Intergenic
970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG + Intergenic
972740298 4:41881509-41881531 CGGCGCGGGGACGGCAGTGCCGG + Intergenic
973735374 4:53866138-53866160 CAGCGTGGGGACCTCAGCGCTGG + Intronic
974069341 4:57110122-57110144 CCGTGCGGGGGTGGCGGCGCCGG - Exonic
975616401 4:76251770-76251792 CCGGCCGGGGACGTTGGCCCCGG + Exonic
976765224 4:88592243-88592265 CGGCGCGGGGACAGCGGCACGGG - Intronic
978126842 4:105146191-105146213 GCGCGCGGGGGCGTGTGCGCGGG + Intronic
981782888 4:148445591-148445613 CCGAGCGGGCACGAGGGCGCGGG - Intergenic
985530290 5:430037-430059 CAGGGCGGGGACGTCTGCTCCGG - Intronic
987108699 5:14664873-14664895 CTGCGCCGAGACGCCGGCGCGGG + Exonic
989576459 5:42992664-42992686 CCGGGCGGCGGCGGCGGCGCTGG + Intergenic
998130413 5:139648799-139648821 CCTCGCGGCGACGGCGGCGGTGG + Exonic
1003624063 6:7726946-7726968 CCGGGCGGGGATGCCGGGGCTGG + Exonic
1007327489 6:41073291-41073313 CCGCGCGGGGATGGCGCCTCGGG + Intronic
1007589726 6:43013870-43013892 GCGCGCGGGAACACCGGCGCCGG - Exonic
1014137545 6:117907203-117907225 CCGGGCGGGGGCGCCGGCGGCGG - Intergenic
1016328240 6:142927060-142927082 CCGGCCGGGGACGGAGGCGCCGG - Intronic
1016433028 6:144008005-144008027 CCGCGCTGCGAGGACGGCGCTGG - Intronic
1019111924 6:169724006-169724028 CCGCGCGGCGGCGGCGGCGGCGG - Exonic
1019475245 7:1241311-1241333 CCGGGCCGGGACATCGGCGCCGG - Intergenic
1019828225 7:3301269-3301291 CCGGGCGGGGGCGGCGGCGGCGG + Intergenic
1020066241 7:5190435-5190457 CAGAGCGGGGAGGCCGGCGCCGG + Exonic
1020288799 7:6706707-6706729 CCGGGCGGTGACGACGGCGGAGG - Exonic
1021231105 7:18086900-18086922 CCGCGCGGCGGCGGCGGCGGCGG + Intergenic
1021958912 7:25852965-25852987 GCGCGTGGGGACGACTGCGCTGG - Intergenic
1022739678 7:33109192-33109214 CCGCGCGCGGACGGCAGCTCGGG + Intronic
1032344295 7:131105744-131105766 CCGCGCGGGTGCCCCGGCGCTGG - Intergenic
1033197506 7:139340410-139340432 AGGCGCGGGGACTACGGCGCAGG + Intronic
1034223059 7:149460356-149460378 CCGAGCGGCGGCGTCGGAGCTGG + Intronic
1036032713 8:4991677-4991699 CCCCCCGGGGGCGTCGGCGCTGG - Intronic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1049482771 8:142834789-142834811 GCGGGTGGGGAGGTCGGCGCGGG + Exonic
1057259668 9:93576677-93576699 CCGCGCGGGGGCGGCGGGGGCGG - Exonic
1057708018 9:97411967-97411989 CCACGCGCGGACGCCGGCGTGGG + Exonic
1061095812 9:128456328-128456350 CCCCGCGGGGTCGACCGCGCCGG - Intronic
1062022420 9:134325929-134325951 CCGCGAGGGGACCCCGGCCCGGG - Intronic
1062491741 9:136808171-136808193 CCGGGCTGGGACGTCCGAGCGGG + Exonic
1062579276 9:137222314-137222336 CCGCGCGGGGTCCGCGGGGCGGG + Intergenic
1203468923 Un_GL000220v1:107977-107999 CCGCGCGGTGCCGCCGGCGGCGG + Intergenic
1203471297 Un_GL000220v1:116451-116473 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1203476744 Un_GL000220v1:151949-151971 CCGCGCGGTGCCGCCGGCGGCGG + Intergenic
1203479118 Un_GL000220v1:160423-160445 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1188811394 X:34657257-34657279 CGGCGCGGGGCCGGCGGCGAAGG - Exonic