ID: 959539863

View in Genome Browser
Species Human (GRCh38)
Location 3:107525222-107525244
Sequence CCGGCCCGGCGCTGCCATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959539863_959539885 30 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539885 3:107525275-107525297 GAGGCAGAGGCAGTGGCGGCGGG 0: 1
1: 1
2: 13
3: 149
4: 923
959539863_959539874 2 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539874 3:107525247-107525269 GCCGGCGGTGCCTCCCTGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 167
959539863_959539884 29 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539884 3:107525274-107525296 GGAGGCAGAGGCAGTGGCGGCGG 0: 2
1: 1
2: 67
3: 475
4: 2540
959539863_959539881 17 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539881 3:107525262-107525284 CTGGGGGGCAGCGGAGGCAGAGG 0: 1
1: 1
2: 10
3: 137
4: 1480
959539863_959539883 26 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539883 3:107525271-107525293 AGCGGAGGCAGAGGCAGTGGCGG 0: 1
1: 0
2: 13
3: 146
4: 1275
959539863_959539876 8 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539876 3:107525253-107525275 GGTGCCTCCCTGGGGGGCAGCGG 0: 1
1: 0
2: 4
3: 49
4: 535
959539863_959539877 11 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539877 3:107525256-107525278 GCCTCCCTGGGGGGCAGCGGAGG 0: 1
1: 0
2: 3
3: 47
4: 469
959539863_959539882 23 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539882 3:107525268-107525290 GGCAGCGGAGGCAGAGGCAGTGG 0: 1
1: 7
2: 26
3: 275
4: 2167
959539863_959539872 0 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539872 3:107525245-107525267 GCGCCGGCGGTGCCTCCCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 136
959539863_959539871 -1 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539871 3:107525244-107525266 GGCGCCGGCGGTGCCTCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 152
959539863_959539870 -2 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539870 3:107525243-107525265 GGGCGCCGGCGGTGCCTCCCTGG 0: 1
1: 0
2: 1
3: 33
4: 244
959539863_959539873 1 Left 959539863 3:107525222-107525244 CCGGAATGGCAGCGCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 959539873 3:107525246-107525268 CGCCGGCGGTGCCTCCCTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959539863 Original CRISPR CCGGCCCGGCGCTGCCATTC CGG (reversed) Intronic
901063728 1:6485375-6485397 CGGGCCCGGGGCTGCCCCTCCGG - Intronic
901416389 1:9119699-9119721 CCGGCCCAGCTTTGCCAATCTGG - Intronic
903161883 1:21494929-21494951 CCAGCCCTGCTCTGCCAGTCTGG - Intergenic
903213467 1:21830981-21831003 CAGGCCCTGCACTGCCATCCAGG - Exonic
903591062 1:24456293-24456315 CCTGCTGGGCCCTGCCATTCGGG + Intronic
903603040 1:24556082-24556104 GCCGCCCGGCGCTGCCACCCTGG - Intergenic
910449050 1:87328724-87328746 CCGAGCCGCCGCTGCCATCCCGG + Exonic
920002330 1:202808252-202808274 CGCGCCCGGCGCTGCCCCTCGGG - Exonic
920609177 1:207421090-207421112 CCGGCTCTGCCCTGCCTTTCGGG + Intergenic
923171479 1:231421589-231421611 CCGGCGCGCCGCTGCCTTCCTGG + Exonic
924038307 1:239957903-239957925 GCAGCCAGGCGCTGCCATCCAGG + Intergenic
1071527314 10:86366176-86366198 GCGGCGCGGCGCGGCCCTTCGGG + Intronic
1083776075 11:64894876-64894898 CCGGCCCGGCCTGGCCCTTCAGG - Exonic
1083967586 11:66052094-66052116 CCGGCCCGCCGCCGGCCTTCGGG + Intronic
1084457856 11:69278667-69278689 CCGGCCAGGCTCTCCCACTCTGG + Intergenic
1090066958 11:123511343-123511365 CCGGGCCCGCACTGCCATTGGGG - Intergenic
1091393873 12:141952-141974 CCAGCCCCGCCCTGCCATTCTGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1105000656 12:132687855-132687877 CCGGCCCGGCGCTCCCGTCCAGG - Intronic
1108373386 13:49792391-49792413 CCGGGCCGGCGCGGCCAGGCGGG + Intronic
1112505166 13:99970904-99970926 CCGGGCCGCCGCTGCCGTCCGGG + Exonic
1113905946 13:113819250-113819272 CCGGCCCGAGGCTGCCCCTCAGG + Intergenic
1114646245 14:24258199-24258221 CCGGCCCAGCACTGACACTCTGG + Intronic
1121304414 14:92897090-92897112 CAGGCCTGGTGCTGCCCTTCAGG + Intergenic
1121313127 14:92945849-92945871 TCTGCCCGGCGCTGCAGTTCAGG + Intronic
1122157579 14:99759443-99759465 CCGGCCCGGGGCTGCCCTCCAGG - Intronic
1122736538 14:103847097-103847119 CCGGCCCCGCGCTGACAGCCCGG + Intronic
1129334263 15:74843088-74843110 CCAGCCGGGCCCCGCCATTCCGG + Exonic
1129743930 15:78004946-78004968 CCAGCCAGGAGCTGCCTTTCAGG + Intronic
1131171932 15:90184971-90184993 CCGGCCCGGCGCAGCCCCTGGGG - Intronic
1131669574 15:94605669-94605691 CTTGCCCAGCTCTGCCATTCAGG + Intergenic
1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG + Intronic
1133738261 16:8631952-8631974 CCGGCCCAGGGCTGACATACTGG + Intronic
1135716993 16:24779914-24779936 CCAGCCCTGGGCTGCCATTTTGG + Intronic
1137282744 16:46992339-46992361 CAGGCCTGCCGCTGCTATTCAGG + Intergenic
1139959794 16:70710948-70710970 CCGGCCAGGGGCTGCCATTCTGG + Intronic
1141590095 16:85062755-85062777 CCAGCCCGGTGCTACCATTTGGG - Intronic
1142411955 16:89921456-89921478 TCTGCCCAGCACTGCCATTCTGG + Intronic
1144756511 17:17682936-17682958 CCCGGCCGGCTCCGCCATTCAGG - Intronic
1146568222 17:33931428-33931450 ACAGCCCGGCGCTGCATTTCAGG - Intronic
1148539993 17:48472744-48472766 CCGGCCCTGCCCTGTGATTCAGG + Intergenic
1151620532 17:75242284-75242306 CCGGGGCTGCGCTGCCCTTCAGG - Intronic
1152657798 17:81528052-81528074 CCGGCCCGGCCCAGCCCTTCCGG - Intergenic
1156384187 18:36591317-36591339 CATGCCCTGGGCTGCCATTCTGG - Intronic
1157764422 18:50286113-50286135 CCTGCCCGGCGCTGCAGGTCTGG + Exonic
1158930999 18:62325188-62325210 CGGGCCCGGCGGTGCCAGCCAGG - Intergenic
1159338461 18:67101702-67101724 CCAGTCCTGCGCTGGCATTCAGG - Intergenic
1160919548 19:1513288-1513310 CTGCCCCGGGGCTGCTATTCCGG + Intronic
1162070514 19:8149580-8149602 CCAGCCCAGAGCTGCCACTCGGG + Exonic
1162570132 19:11466762-11466784 CCGGCCCGGCCCTGCCCAACGGG - Exonic
1162975872 19:14206732-14206754 CCGGCCCGGCGCCCCCCCTCCGG - Intergenic
1167040614 19:47020820-47020842 CCGGCCCGGGGCTGGCGCTCCGG - Intronic
1167297780 19:48661981-48662003 ACGGCCAGCCGCTGCCATGCCGG + Exonic
1167739034 19:51312754-51312776 CCGGCCCGGCCCTCCCAGTTGGG + Intronic
925185130 2:1842092-1842114 CGGGCCCGGCGCTGGCACACGGG + Intronic
927927556 2:27024376-27024398 ACGGCCCGGCCCTGCCAGCCTGG + Intronic
932469624 2:71945308-71945330 CCCGCCCAGCGCTGCAAGTCTGG + Intergenic
933684643 2:85133514-85133536 CGGGCCCGGCGCTGCCCGGCCGG - Exonic
933714350 2:85349353-85349375 CCTGCCCCGCCCTGCCCTTCTGG - Intronic
938716710 2:134028060-134028082 CCGCCCCTGCCCTGCCCTTCAGG + Intergenic
942565748 2:177264121-177264143 CCGGCGCGGCCCGGCCCTTCCGG - Intronic
948681758 2:239639952-239639974 CCGTCCCGGCCCTGGCACTCTGG + Intergenic
1171347668 20:24478274-24478296 CCTGCCTGGCGCTGCCACTCTGG - Intronic
1173192536 20:40887323-40887345 CGGGCCCTGCGCTCCCATTCAGG + Intergenic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1178493759 21:33070513-33070535 CCGGCCGGGCGCTGCCGCCCGGG - Exonic
1182358616 22:29734062-29734084 CTGGGCGGGCGCTGCCATCCTGG - Intronic
1183491723 22:38120491-38120513 CCTGCCCGGCTCTGCCCTGCCGG - Intronic
1184698265 22:46151290-46151312 CCGGCCCAGCGCAGCCTGTCCGG - Intronic
952476633 3:33717730-33717752 CCGGCCCGGCGCTCGCGTCCGGG + Intronic
959539863 3:107525222-107525244 CCGGCCCGGCGCTGCCATTCCGG - Intronic
964438261 3:156675559-156675581 GCCGCCCGGCTCTGCAATTCCGG - Intronic
967992598 3:195142678-195142700 CCTGCTCGGCGGTGCCATTGAGG - Intronic
969538998 4:7774150-7774172 CTGGCCCAGGGCTGCCACTCTGG + Intronic
985489694 5:172071-172093 ACGGCCCTGCTCTGCCATTGGGG - Intronic
985688458 5:1294336-1294358 CCAGCTCGGCGCTGCCACTCAGG - Exonic
985782306 5:1877791-1877813 CAAGCCCGGCGCTGCCACGCCGG - Exonic
1006481215 6:34296005-34296027 CAGGCCAGGCACTGCCACTCTGG + Intronic
1014535649 6:122610453-122610475 GCGGCCCGGAGCTGCGACTCGGG - Intronic
1019475254 7:1241337-1241359 CCTGCCCGCCGCTGCGACTCCGG + Intergenic
1027244543 7:76358501-76358523 GCCCCGCGGCGCTGCCATTCAGG - Intronic
1057189806 9:93080549-93080571 CAGGCCCGGCTCTGCATTTCTGG + Intronic
1062394459 9:136347167-136347189 CCGGCCCGGCCCATCCATGCCGG + Intronic
1062568763 9:137174896-137174918 CCCGCCAGGCGCTGCCCTGCAGG - Exonic
1188003996 X:25005142-25005164 CCGGCCCGGCCCGGCCCCTCGGG - Intronic
1198028334 X:132730819-132730841 CCTTCCCAGCTCTGCCATTCTGG - Intronic