ID: 959540427

View in Genome Browser
Species Human (GRCh38)
Location 3:107531300-107531322
Sequence TGGAACCTAGAGCTCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959540427_959540433 10 Left 959540427 3:107531300-107531322 CCACCAAAGAGCTCTAGGTTCCA 0: 1
1: 0
2: 1
3: 12
4: 158
Right 959540433 3:107531333-107531355 CTCTATTGCTTATTAGTTGCGGG 0: 1
1: 0
2: 1
3: 12
4: 148
959540427_959540432 9 Left 959540427 3:107531300-107531322 CCACCAAAGAGCTCTAGGTTCCA 0: 1
1: 0
2: 1
3: 12
4: 158
Right 959540432 3:107531332-107531354 CCTCTATTGCTTATTAGTTGCGG 0: 1
1: 0
2: 1
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959540427 Original CRISPR TGGAACCTAGAGCTCTTTGG TGG (reversed) Intronic
901181066 1:7342221-7342243 TGGAGCCTGGAGCTCTTCTGAGG - Intronic
903569615 1:24294700-24294722 TGGAGCCTGGAGCTCTTGGAAGG + Intergenic
903687613 1:25143395-25143417 TGGAACCCAGACCTCTGAGGAGG - Intergenic
904249025 1:29209499-29209521 TGGAAGCCAGAGGTCTTTGTGGG + Intronic
907938399 1:59063620-59063642 TGGAAGCCAGACCTCTTTGGAGG + Intergenic
912073512 1:105842934-105842956 TGGAACTGAGATCTTTTTGGAGG - Intergenic
913515328 1:119600545-119600567 AGGAACCCAGAGCTCTCTGGGGG + Intergenic
914823850 1:151126884-151126906 AGGAACCTAGAGTTCTCTGATGG + Intergenic
916013314 1:160726224-160726246 TGGAACCTGGAGCTCAGAGGTGG - Intergenic
916132696 1:161625356-161625378 TGGAACCTAGAGATGTTTTGTGG + Intronic
917773021 1:178301066-178301088 TGGAACCCAGAGCTTTTGGCTGG + Intronic
918735342 1:188054980-188055002 TGGAAGTGAGAGCTCCTTGGAGG - Intergenic
919077495 1:192831034-192831056 TGGAAGGTAGAGCACATTGGAGG + Intergenic
920352886 1:205349362-205349384 TGGAACCTAGAGGGCCTTAGTGG + Intronic
920647108 1:207811832-207811854 TGGAACCAGAATCTCTTTGGAGG - Intergenic
920744478 1:208613595-208613617 TGCAACCCAGAGCTCTCTTGAGG + Intergenic
923987593 1:239399017-239399039 TGGAACCAAGGTCTCTTTGAAGG + Intronic
924791839 1:247257968-247257990 TTGAACCTGGACCTCCTTGGAGG - Intergenic
1064722548 10:18244728-18244750 TGGAACATGGACATCTTTGGGGG - Intronic
1065658844 10:27983385-27983407 TGGGACCCAGACCTCTTGGGAGG - Intronic
1066008106 10:31166547-31166569 TGGGACCTAGATATCTTTGGGGG + Intergenic
1069897078 10:71686593-71686615 TGGAACTGAGAGCTCTTAGGGGG - Intronic
1072286151 10:93917550-93917572 TGGCTCTTAGAGCTCTTAGGAGG - Intronic
1072445811 10:95497602-95497624 TTGAACCGTGAGCTCATTGGTGG - Intronic
1072590782 10:96826888-96826910 TAGCAACTAGAGCTCTTTGAAGG - Intergenic
1073752822 10:106549202-106549224 TGGAACCTAGATATTTTGGGTGG - Intergenic
1075226859 10:120637411-120637433 TGGATCCTAGGGCTCCTTAGAGG - Intergenic
1078141964 11:8699433-8699455 AGGAACTTAGAGCTCGCTGGAGG + Intronic
1078147236 11:8730317-8730339 TGGAACCTTGGGCTCCTTGGAGG - Exonic
1087817883 11:102679088-102679110 TGAAACCTACCCCTCTTTGGAGG - Intergenic
1088817845 11:113433563-113433585 TGGAACCTGGAGTTCTTCAGAGG + Intronic
1090671844 11:128953100-128953122 TAGAACATAGACATCTTTGGGGG + Intergenic
1091080448 11:132662177-132662199 ATGAACCAAAAGCTCTTTGGGGG - Intronic
1097118519 12:56716724-56716746 TGGAATGAGGAGCTCTTTGGGGG + Intronic
1101808488 12:108086897-108086919 TGGAACATACAGAACTTTGGAGG - Intergenic
1104222305 12:126796753-126796775 TAGAACCTGGATGTCTTTGGAGG + Intergenic
1104485459 12:129148270-129148292 TTGGACGTAGACCTCTTTGGGGG - Intronic
1107028957 13:35831531-35831553 TGGGACGCAGGGCTCTTTGGTGG + Intronic
1108229388 13:48320392-48320414 GGGAACCTAAAGCTCCCTGGTGG + Intronic
1108421813 13:50258112-50258134 TGAAACCCAGAGCTCTAAGGAGG - Intronic
1113265358 13:108610416-108610438 TGGGACCTGGAGCGCTTTGTGGG + Intronic
1114746729 14:25156391-25156413 GAGCACCTAGAGCTCATTGGTGG - Intergenic
1115724733 14:36200785-36200807 TGGCACCAAGAGATATTTGGAGG - Intergenic
1117231114 14:53719709-53719731 TGAAACCCTGAGCTCTTTGAGGG - Intergenic
1120055868 14:79923553-79923575 TGTAGCCTAGGGCTTTTTGGTGG + Intergenic
1124410951 15:29436291-29436313 TGGGACCCAGGGCTCTTTGCAGG - Intronic
1124886669 15:33693682-33693704 TGCAACCTACAGCCCTTGGGAGG - Intronic
1127383724 15:58450914-58450936 TGAATACTAGAGGTCTTTGGAGG + Intronic
1128816778 15:70615788-70615810 TGGGACCTAGATCTCTCAGGAGG + Intergenic
1129344775 15:74910210-74910232 TGCAACCTAGAGTTGGTTGGGGG - Intergenic
1130745190 15:86645826-86645848 TGGAACGTTCAGCTCATTGGTGG - Intronic
1132251315 15:100337547-100337569 TGCAGCCCAGAGCTCCTTGGTGG + Intronic
1133229207 16:4358514-4358536 TGGGACCTAGAGCTCATGGCTGG + Intronic
1133363461 16:5192396-5192418 AGGAACACAGAGCTCCTTGGGGG + Intergenic
1139636516 16:68261444-68261466 TTGAACCTAGAGTTCTTTTTAGG + Intergenic
1140281598 16:73559712-73559734 TGGAATAAAGAGGTCTTTGGCGG + Intergenic
1142225139 16:88873515-88873537 TGGAACCCATAGCTCTGGGGAGG - Intergenic
1143825498 17:9603035-9603057 TGTTACATGGAGCTCTTTGGAGG - Intronic
1146517795 17:33502677-33502699 GGGAAAATAGAGCTGTTTGGTGG - Intronic
1148976516 17:51534906-51534928 TGTAACAAAGAGTTCTTTGGTGG - Intergenic
1149268556 17:54953408-54953430 TGTAACCTGGGGCTCCTTGGGGG + Intronic
1152124163 17:78436449-78436471 TGGAGCCTAGAACTTTTTTGAGG - Intronic
1152854295 17:82655359-82655381 TGTGACTCAGAGCTCTTTGGAGG - Exonic
1154975091 18:21449691-21449713 TGTGACCCAGAACTCTTTGGCGG + Exonic
1156352770 18:36315366-36315388 TGGGATCCAGAGCTCTTGGGTGG - Intronic
1160105619 18:75972301-75972323 TGAAACCTCGAACTCTTTGTGGG + Intergenic
1160237513 18:77097780-77097802 TGGAAGGCAGAGCTCTTTGTGGG + Intronic
1161235134 19:3193896-3193918 AGGAACCCGGAGCTCTGTGGTGG + Intronic
1161729902 19:5952958-5952980 TTAAACCCAGAGCTCTGTGGGGG + Intronic
1166412275 19:42563672-42563694 AGGAACCTGGAGCTCCTTGTGGG + Intergenic
1166719405 19:44988572-44988594 TAGAACCTAGGGACCTTTGGGGG - Intronic
925069899 2:958041-958063 AGGTACTAAGAGCTCTTTGGAGG + Intronic
925635594 2:5938532-5938554 TGGAAACAAGAGCACTCTGGTGG + Intergenic
926766518 2:16327098-16327120 TTAAACATACAGCTCTTTGGGGG + Intergenic
929108508 2:38386905-38386927 TGGATCCTAGTGCTCTTGTGTGG - Intergenic
929259102 2:39844929-39844951 TGGAACATGGATCTCTTTTGGGG + Intergenic
929501817 2:42496857-42496879 TGGAAGGAAGAGCTCTGTGGTGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933625602 2:84594857-84594879 TCAAACGTAGAACTCTTTGGTGG + Intronic
935682597 2:105651114-105651136 TGCAACCTAGATCTCTTGTGTGG + Intergenic
936104379 2:109612984-109613006 TGTAAACAAAAGCTCTTTGGAGG - Intronic
936385452 2:112024591-112024613 TGGAACAGAGGCCTCTTTGGGGG - Intronic
937583203 2:123514388-123514410 TAGAACCTGGACATCTTTGGGGG - Intergenic
938406924 2:131037983-131038005 TGGGACCTAGAGCTCTAAGAAGG + Intronic
938979984 2:136517187-136517209 TGGAACCTAGGGCCTTTTGTGGG + Intergenic
939597847 2:144149495-144149517 TGCAATTTAAAGCTCTTTGGTGG - Intronic
941139258 2:161757404-161757426 TAGATTCTAGAGCTCTTGGGAGG + Intronic
943117973 2:183696685-183696707 TGGATCCTAGATGTCTTTGGTGG - Intergenic
943354167 2:186831250-186831272 TGGAAACCAGAGCTCTTGTGGGG - Intronic
946878249 2:224151665-224151687 TGGAAAATTGACCTCTTTGGGGG - Intergenic
946891670 2:224283306-224283328 TTGAACCTTGAGGTCTTTGAAGG + Intergenic
947634546 2:231673411-231673433 TGGAAGTGAGAGCTCTGTGGGGG - Intergenic
947676649 2:231987628-231987650 GGGAATCTGGAGCTCTTTAGTGG + Intronic
947791003 2:232869316-232869338 TGAAACATAGAGCTCGTGGGTGG + Intronic
948897661 2:240934798-240934820 TGCAAGCCAGAGCTCTTGGGCGG - Intronic
1170431329 20:16279293-16279315 TGGAACCAAGGGTCCTTTGGGGG + Intronic
1174890166 20:54383340-54383362 TGGATGCTGGAGCTGTTTGGTGG - Intergenic
1175155845 20:56971083-56971105 TGGAACCTAAAGCCCTGTGAGGG - Intergenic
1176014739 20:62925131-62925153 TGGAGCCTAGGGCTCTTTAGTGG - Intronic
1177874287 21:26612018-26612040 TAGAACCTGGATATCTTTGGGGG + Intergenic
1180682468 22:17638117-17638139 TGAATCCGAGAGTTCTTTGGAGG - Intronic
1180762464 22:18220622-18220644 GGGAACCTAAAGCTCCCTGGTGG - Intergenic
1180773203 22:18403986-18404008 GGGAACCTAAAGCTCCCTGGCGG + Intergenic
1180804558 22:18653535-18653557 GGGAACCTAAAGCTCCCTGGTGG + Intergenic
1180806192 22:18715875-18715897 GGGAACCTAAAGCTCCCTGGCGG - Intergenic
1181217139 22:21341656-21341678 GGGAACCTAAAGCTCCCTGGTGG - Intergenic
1181503067 22:23330674-23330696 TGCAACCGAGAGTACTTTGGGGG + Intergenic
1183446390 22:37858605-37858627 TGGCAGCTTTAGCTCTTTGGTGG - Intronic
1203235035 22_KI270731v1_random:144968-144990 GGGAACCTAAAGCTCCCTGGTGG + Intergenic
950272228 3:11626827-11626849 GAGATCCTAGAGCTCTTTAGAGG - Intronic
955387226 3:58489349-58489371 TGCAACCCTGAGCTCTGTGGAGG + Intergenic
959540427 3:107531300-107531322 TGGAACCTAGAGCTCTTTGGTGG - Intronic
962480707 3:135795844-135795866 TGTAAACTACGGCTCTTTGGAGG + Intergenic
963010526 3:140765888-140765910 TTGCACCTACAGCTCTTTGATGG + Intergenic
963966216 3:151373835-151373857 TAGAACCAAGGGCTCCTTGGAGG - Intronic
964573321 3:158136431-158136453 TGCAAACTAGAGCTCTGTAGGGG - Intronic
964650922 3:159010275-159010297 TGGTACCAAGACCTCTCTGGTGG + Intronic
965206322 3:165721913-165721935 TGGAACTTACAGCTCTTTAACGG + Intergenic
968183334 3:196613482-196613504 TGGAACTTAGGGCTCTTTTATGG + Intergenic
968622439 4:1610041-1610063 TGGAACCCAGGGCTTTGTGGCGG + Intergenic
969334894 4:6502040-6502062 TGGTTCCTAGTGCTGTTTGGTGG - Intronic
976348015 4:84027513-84027535 TAGAACATAGATATCTTTGGTGG + Intergenic
978752841 4:112271786-112271808 TTGAACCTAGACCTCTTTCTTGG - Intergenic
980015710 4:127647612-127647634 TGAAACATAGACATCTTTGGGGG + Intronic
990422787 5:55653311-55653333 TGGAACCAAGGGATATTTGGTGG - Intronic
993966819 5:94369208-94369230 TGGAATCTAGAGCTGTTGTGTGG + Intronic
996801924 5:127413753-127413775 AGGAAGCTAGAGCACTTTGGAGG - Intronic
999510899 5:152250746-152250768 TTGAACCCTTAGCTCTTTGGGGG + Intergenic
1001735196 5:173991923-173991945 TAGAACCTAGTGCTTTTTGAGGG + Intronic
1003823111 6:9922634-9922656 TGCCACTTAGAGCTCCTTGGTGG - Intronic
1005765029 6:29002970-29002992 TGAAGCCTTGTGCTCTTTGGTGG - Intronic
1006565009 6:34948605-34948627 AGGAAGCTAGAGCACTTTGAGGG - Intronic
1012271271 6:97215150-97215172 AGGAATCTTGAGCTCTTTGGTGG - Intronic
1014979958 6:127934222-127934244 TAGAATCTAGAGATATTTGGAGG + Intergenic
1015812223 6:137172157-137172179 TGGAACTTGGAGCAATTTGGTGG - Intronic
1018986898 6:168644563-168644585 TGGTACCCAGAGCTCTTTCCAGG + Intronic
1019291430 7:252431-252453 TGGAGCCCAGAGCACATTGGAGG + Intronic
1019291454 7:252522-252544 TGGAGCCCAGAGCACATTGGAGG + Intronic
1019324124 7:429677-429699 CGGGGCCTAGAGCTCTGTGGAGG + Intergenic
1019564224 7:1671601-1671623 TGCAAGCTGGACCTCTTTGGAGG - Intergenic
1020123204 7:5517298-5517320 CGAAACCATGAGCTCTTTGGGGG - Intergenic
1021881008 7:25095567-25095589 TAGGACATAGATCTCTTTGGGGG - Intergenic
1028876030 7:95824313-95824335 AGGAACCTACAGCTCTTATGAGG - Intronic
1030435654 7:109516151-109516173 TGGAGCCTAGAGAACTATGGAGG - Intergenic
1033394417 7:140960086-140960108 GGGGTCCTAGAGGTCTTTGGGGG - Intergenic
1035464737 7:159067336-159067358 TGGAATCCAGAGCTCTGTGTTGG - Intronic
1035486787 7:159232452-159232474 TGGAATACAGAGCCCTTTGGGGG - Intergenic
1036633085 8:10529127-10529149 TGGAACTTGGACCTCTTTGGGGG + Intronic
1037066904 8:14593090-14593112 TGGAATCTGGACATCTTTGGGGG - Intronic
1039918515 8:41876620-41876642 TGGAAACCAGAGCCCTTTAGAGG - Intronic
1040849759 8:51887227-51887249 TAGAACATGGACCTCTTTGGGGG + Intronic
1041340021 8:56835204-56835226 TGGCCCCTAGAGGTCTTTTGGGG - Intergenic
1041679385 8:60572774-60572796 TATAAGCTAAAGCTCTTTGGGGG - Intronic
1048393459 8:133989808-133989830 TGGGCCCTAGATCTCTTTGAGGG + Intergenic
1049134839 8:140887073-140887095 TGGGACCCTGAGCTGTTTGGGGG + Intronic
1049619557 8:143591923-143591945 TGGAACATGGAGTTCTTTGCGGG + Intronic
1051856242 9:21569321-21569343 TGGAACCTAGAGATATTTGGGGG + Intergenic
1057309062 9:93930310-93930332 TGGACCCTAGAGCTCCGGGGAGG + Intergenic
1057680671 9:97180223-97180245 TGGAACGCAGAACTCTTTAGAGG - Intergenic
1059316532 9:113430307-113430329 TAGAAACTAGAGCTTTTTGCCGG - Intergenic
1059596082 9:115722157-115722179 TAGAACCTGGACATCTTTGGTGG + Intergenic
1061598284 9:131646970-131646992 TGGATCCGAGTGCTCTTGGGTGG - Intronic
1062231507 9:135484571-135484593 GGGAACCTACAGCTCCCTGGCGG - Exonic
1062501787 9:136854911-136854933 TGGAACCAAGAGCTGGCTGGGGG - Intronic
1189425730 X:40897974-40897996 CAGAAACTTGAGCTCTTTGGGGG + Intergenic
1189513302 X:41685447-41685469 TAGTACCTAGAGCTTTTTTGTGG + Intronic
1192188855 X:68978502-68978524 TGGAAACTATAGCCCTTTGGGGG - Intergenic
1194188471 X:90805700-90805722 GGGAATCTAGACCTCTTTGAAGG + Intergenic
1195953236 X:110300811-110300833 TGGAAACTATAGCTATGTGGTGG - Intronic
1197887666 X:131235292-131235314 TCAAACCCAGAGATCTTTGGGGG + Intergenic
1199785823 X:151103904-151103926 TGGGACCTAGACCTCTGAGGAGG + Intergenic
1199924750 X:152450736-152450758 TGGTGCCTAGAGCTGTCTGGGGG + Intronic