ID: 959542813

View in Genome Browser
Species Human (GRCh38)
Location 3:107559326-107559348
Sequence CTGGGACCTGCTCTCAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 364}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959542813 Original CRISPR CTGGGACCTGCTCTCAGCTG AGG Intronic
900245648 1:1634913-1634935 CTAGGACTTGCTCAGAGCTGGGG + Intronic
900256878 1:1702070-1702092 CTAGGACTTGCTCAGAGCTGGGG + Intronic
900667998 1:3828594-3828616 CTGGGACCTGCTGGCACCTCAGG - Intronic
901054312 1:6441630-6441652 ATGGGACTTGAACTCAGCTGTGG + Intronic
901303989 1:8219008-8219030 ATGGAATATGCTCTCAGCTGAGG + Intergenic
902280657 1:15371853-15371875 CTGGGACCAGGGCTCAGCAGCGG - Intronic
902314103 1:15604645-15604667 CTGGGTGCAGCTCTCATCTGAGG - Intergenic
902377484 1:16036665-16036687 CTGGGAGCTGTCCCCAGCTGAGG - Intergenic
902382658 1:16059923-16059945 CTGGGAGCTGTCCCCAGCTGAGG - Exonic
902479996 1:16706703-16706725 CTGGGACTTGAACTCAGCTGTGG - Intergenic
903630420 1:24764934-24764956 CTAGGAACTGCTCTAAGCTCTGG + Intronic
903761564 1:25702255-25702277 GTGGGCCCTGCTGTCAGCTCTGG - Intronic
904327880 1:29739231-29739253 GTGGGACCTGCTCCCTGATGGGG + Intergenic
907373531 1:54018007-54018029 CTGGGGACAGCTCTCACCTGGGG + Intronic
907373543 1:54018075-54018097 CTGGGGACAGCTCTCACCTGGGG + Exonic
907821245 1:57971789-57971811 GTGGGACCTGCCCTCTTCTGTGG - Intronic
910493350 1:87797746-87797768 CAGCTACCTGCTCTCTGCTGGGG + Intergenic
913009486 1:114669656-114669678 CTGGGCGCCGCTCTCTGCTGGGG - Intronic
914079313 1:144391846-144391868 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914099866 1:144574656-144574678 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
914174214 1:145260393-145260415 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914528878 1:148501577-148501599 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914637515 1:149565531-149565553 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
915005442 1:152630680-152630702 CTGGGGCCTGCCCTGGGCTGGGG + Intergenic
915165769 1:153946860-153946882 CTGGGTCCTGCAGTCAGATGTGG + Intergenic
918145397 1:181751638-181751660 ATGAGACTTGCTCTCAACTGTGG + Intronic
919088514 1:192950046-192950068 CTAGGAATTGCCCTCAGCTGAGG + Intergenic
920032582 1:203046161-203046183 CTGTCATCTGCTCTCTGCTGAGG + Intronic
920111566 1:203590941-203590963 CTGGGAAGGGCTCTCAGCTCTGG - Intergenic
920184300 1:204151005-204151027 CTGGGACCTGTGTCCAGCTGGGG + Intronic
920531723 1:206707106-206707128 CAGGGCCCTGCTTGCAGCTGTGG + Intronic
922316839 1:224449885-224449907 CTGTGGCCTGCTTTCAGTTGTGG + Intronic
924728332 1:246690314-246690336 CAGGCACCTGTTCCCAGCTGAGG + Intergenic
924813529 1:247423778-247423800 CTGAGATGCGCTCTCAGCTGGGG - Intronic
1063614462 10:7589958-7589980 CAGGGTCCTTTTCTCAGCTGAGG + Intronic
1064135682 10:12748544-12748566 CTGGGAGCTGCTGTAAGCTTTGG + Intronic
1065158043 10:22890931-22890953 CTGGGGCCTGTTGTCAGGTGGGG + Intergenic
1065726523 10:28672544-28672566 CTGGGTACTGCTCTCAGCAAGGG - Intergenic
1066412068 10:35181462-35181484 TTGGTACCTGCTCACAGCAGGGG + Intronic
1066954059 10:42149138-42149160 CTGGGACCAGCCCTCACCTTGGG - Intergenic
1067945220 10:50684772-50684794 CTGGGCCCTGCTCACACCTGGGG + Intergenic
1068657910 10:59593478-59593500 CTGGTACCTGCTTTCACCTTTGG + Intergenic
1068788891 10:61006392-61006414 CTGGGACTTGTACTCAGCTCTGG - Intergenic
1069996369 10:72344482-72344504 GTGGGGCCTGCTCACAGCCGTGG + Intronic
1070267061 10:74913798-74913820 CTGGGCACAGCTCTCTGCTGGGG - Intronic
1070399410 10:76040228-76040250 CAAGGTCCTGCTCCCAGCTGGGG + Intronic
1070586606 10:77771530-77771552 CTGGGTCCTGTACTCAGCTGGGG - Intergenic
1070866730 10:79711644-79711666 CTGGGCCCTGCTCACACCTGGGG + Intronic
1070880519 10:79849765-79849787 CTGGGCCCTGCTCACACCTGGGG + Intronic
1071633640 10:87233867-87233889 CTGGGCCCCGCTCACACCTGGGG + Intronic
1071647088 10:87366083-87366105 CTGGGCCCCGCTCACACCTGGGG + Intronic
1073042800 10:100618783-100618805 CTGGGGCCTGGTCTGAGCAGTGG + Intergenic
1073599815 10:104835646-104835668 CTGGCACCTCCACTCAGCTTTGG - Intronic
1074049533 10:109869246-109869268 CGGGGATCTGCTCTCTGCTTTGG - Intronic
1074877172 10:117622486-117622508 CAGGCAGCTGCTCTCAGGTGAGG - Intergenic
1076536805 10:131183698-131183720 CTGGGCCCTGAGCTCAGATGAGG - Intronic
1076827450 10:132976216-132976238 CTGAGACTTTGTCTCAGCTGAGG - Intergenic
1077216376 11:1396852-1396874 CTGGGCCCTGCCCTCAGCTCTGG + Intronic
1077721966 11:4638587-4638609 CTGGGACTGACTCTCACCTGGGG + Intergenic
1077910483 11:6568097-6568119 CTGGGACCCAGTCTCAGTTGTGG + Exonic
1078087622 11:8243685-8243707 CTGGGCCCTGCACCCAGGTGAGG + Intronic
1078101428 11:8332522-8332544 ATGGCACCTGCTCTCTGCAGAGG + Intergenic
1079933094 11:26589555-26589577 CAGGGACCTGCTTTCTTCTGGGG - Intronic
1080165661 11:29233107-29233129 CTGGGATCTGCACTCTTCTGGGG - Intergenic
1080697941 11:34619421-34619443 CAGGGCCCTGCTCTCAGATCTGG + Intergenic
1080868192 11:36213689-36213711 CTGGGCCCTGTGCTCAGGTGCGG - Intronic
1082814916 11:57501313-57501335 GTTGGTGCTGCTCTCAGCTGAGG + Exonic
1083367215 11:62148582-62148604 CTGGGGTCTGCCCTGAGCTGTGG + Intronic
1083617204 11:64032172-64032194 CTTGGGCCTGTTCTCAGCTGGGG - Intronic
1084176547 11:67425264-67425286 CTGTGACCCGCTCTCCACTGTGG - Exonic
1084370041 11:68735282-68735304 CTCAGACCTGCCCTGAGCTGGGG + Intronic
1084423703 11:69072932-69072954 CAGTGTTCTGCTCTCAGCTGAGG + Exonic
1084742358 11:71147887-71147909 CTGGGAGATTCTCTCATCTGTGG - Intronic
1084973461 11:72783725-72783747 CTGGTACCTGCTATCTGCTGAGG - Intronic
1085712367 11:78841675-78841697 CCTGGACGTGCTGTCAGCTGTGG - Intronic
1085742989 11:79092784-79092806 CTGGTTGCTGCTCCCAGCTGAGG + Intronic
1085753174 11:79180199-79180221 CAGGGATCTGCTCTCACCTTGGG - Intronic
1087944494 11:104141783-104141805 CTGTTACCTGCTCTTGGCTGCGG - Intronic
1088619941 11:111671538-111671560 CTGGTACATGCTCTCAGCCTTGG + Intronic
1089284549 11:117397109-117397131 CTGGCACCTCCTCTCTGCTGAGG + Exonic
1090349843 11:126101013-126101035 CTGTGACCTGCTCAGAGCAGGGG + Intergenic
1091844922 12:3648500-3648522 CTGGGAGGTGCTCTCAGCACAGG + Intronic
1095462254 12:42455477-42455499 CTGGGAACTCCTTTCAGCTCTGG - Intronic
1096085968 12:48865357-48865379 CTGGAGTCTGCTCTCAGGTGAGG - Intronic
1097477502 12:60076513-60076535 CTGGGTCAGGCTTTCAGCTGAGG + Intergenic
1098251393 12:68573528-68573550 CTGGGACCTGCTCACACTTCTGG + Intergenic
1099333978 12:81329864-81329886 CCGGGTCCGGGTCTCAGCTGGGG + Intronic
1099444879 12:82740816-82740838 CTTTGACCTGCTCTCAGAAGGGG + Intronic
1101223639 12:102666202-102666224 CTGGGCCCTGTTCTAAACTGCGG - Intergenic
1102533298 12:113562705-113562727 CCAGGACATGCTCTGAGCTGGGG - Intergenic
1104067874 12:125320109-125320131 CTGGGTCCTGCACTGAGCTTTGG + Intronic
1105908041 13:24833798-24833820 CAGGTTCCTGTTCTCAGCTGTGG - Intronic
1106457146 13:29937415-29937437 CTGGGACCTGCCCGAGGCTGTGG - Intergenic
1106788298 13:33129359-33129381 CAGGGACCTGCTCTCTGCCCAGG + Exonic
1107502270 13:40992680-40992702 CTGGGACCTTCTATCAGTTAGGG + Intronic
1112846216 13:103647079-103647101 CTGGGGTCTGCTCTCACCTTTGG - Intergenic
1114452665 14:22837231-22837253 TTGGGCTCTGCTCTCAGCTCTGG + Intronic
1114524506 14:23359566-23359588 GCGGGACAGGCTCTCAGCTGAGG + Exonic
1115645417 14:35365792-35365814 CAAAGACCTGCTGTCAGCTGAGG + Intergenic
1116444085 14:44988092-44988114 CTGGGGCCTGCTGTGAGGTGGGG + Intronic
1116905636 14:50400939-50400961 CTGGGTTCTGCACTCAGATGAGG - Intronic
1119032970 14:71206840-71206862 CTGTGTCCAGCTCTCAGCTTCGG - Intergenic
1121241067 14:92430551-92430573 CTGGGCCCTGCTCACAGTCGAGG + Intronic
1121487505 14:94330059-94330081 CTGGGGCATGCTCTCACCTCTGG + Intergenic
1122436777 14:101706183-101706205 CGGGAGCCTGGTCTCAGCTGGGG + Intergenic
1122628846 14:103098267-103098289 CTGGGACCTGCTGACACCTTGGG + Intergenic
1122691376 14:103533497-103533519 CTGGGTCCTGGTCTCTGCTGAGG + Intronic
1122718476 14:103708950-103708972 CCGGAACCTGCTCTCAGCACCGG - Intronic
1122816073 14:104314735-104314757 CTGGCTCCTGCTCTCTTCTGTGG + Intergenic
1123043149 14:105498787-105498809 CCGGGACCTGCGGGCAGCTGTGG + Exonic
1123148175 14:106154253-106154275 CTGGGCCCTGCCCTCTGCTCAGG - Intergenic
1123758273 15:23413898-23413920 CTGAGACCTTCTCCCAGCTCTGG - Intergenic
1125054331 15:35339905-35339927 CCAGGACCTGAACTCAGCTGTGG - Intronic
1125524922 15:40368669-40368691 CTGGGGCCTGACCTCTGCTGCGG + Exonic
1126541780 15:49831892-49831914 CTGGGACTTCCACTCAGCCGAGG - Intergenic
1127865196 15:63026876-63026898 CTGGGCACCCCTCTCAGCTGTGG + Intergenic
1128047801 15:64634381-64634403 CTGGGATCTGCAATCAGATGAGG - Intronic
1128162628 15:65434293-65434315 CTGAGACCTGCTCTCTCCTGGGG + Intergenic
1128247870 15:66145141-66145163 CTTGGGCCTGCTCTCAGCTCAGG - Intronic
1128837793 15:70825248-70825270 CTGGCACCTGCTCCTAGTTGAGG - Intergenic
1130028941 15:80294858-80294880 CTGGGGCCTCCTCTCTGCTGAGG - Intergenic
1130149579 15:81300942-81300964 CTGGGTCCTAGTCTCAGCTTAGG + Intronic
1130250090 15:82294404-82294426 GTGGGAGATGCTCTCAGCAGGGG + Intergenic
1130546046 15:84858121-84858143 CTGGGCTATGCTCTCTGCTGAGG - Exonic
1130546225 15:84858989-84859011 CTGGGAGGGGCTCCCAGCTGAGG - Intronic
1130601511 15:85278018-85278040 TTGGGAGCTGCTCTCACCTAGGG - Intergenic
1130884057 15:88078724-88078746 CTGGGACCTAAGCTCAGCAGGGG + Intronic
1130960704 15:88657082-88657104 CTGGGGCCAGCTCTCAACTGTGG - Intergenic
1131281845 15:91027885-91027907 TTGGGAGCTGCTCTCACCTAGGG + Intergenic
1131872872 15:96779331-96779353 CTTGGACCATCTCTCAGCTCTGG + Intergenic
1132030830 15:98437596-98437618 CAGGGACATGCTCTGTGCTGGGG - Exonic
1132316482 15:100893987-100894009 CTGGCACCCGCCCTCTGCTGTGG + Exonic
1132367320 15:101266962-101266984 CTGGTAACTGCTCTCAGGTTTGG + Intergenic
1132934743 16:2474750-2474772 CTGGGACGGGCCCTGAGCTGAGG - Intergenic
1133168373 16:3964802-3964824 CTGGGAACTGCCCTCCCCTGTGG + Exonic
1134458065 16:14408996-14409018 CTGAGACCTTCTCCCAGCTCTGG + Intergenic
1136297917 16:29314186-29314208 CTGGGCCCTGTTCCCAGGTGAGG + Intergenic
1136395891 16:29992184-29992206 GTGGGAGCCCCTCTCAGCTGTGG + Intronic
1136749106 16:32616914-32616936 CTGTGTGCTGCTCTCTGCTGAGG - Intergenic
1137009560 16:35309392-35309414 ATGGGACCGCCTCTCATCTGGGG - Intergenic
1137423076 16:48352798-48352820 CTGGGAGCTGCACTCTTCTGAGG - Exonic
1138124100 16:54424568-54424590 CTGTCCTCTGCTCTCAGCTGTGG + Intergenic
1139747839 16:69088786-69088808 CTGAGACCTGCTCTTACCTCTGG - Intergenic
1140696216 16:77536825-77536847 CTGCTGCTTGCTCTCAGCTGTGG + Intergenic
1141600983 16:85126244-85126266 CTGGGACCCGCCCGAAGCTGGGG + Intergenic
1142025245 16:87809335-87809357 CTAGAACCTGTTCACAGCTGTGG + Intergenic
1142059562 16:88020691-88020713 CTGGGCCCTGTTCCCAGGTGAGG + Intronic
1142127119 16:88415683-88415705 CTGGGACGTGCACCCAGCTCTGG - Intergenic
1142206009 16:88783648-88783670 CTGGGACCTGCTCCCAGTGCAGG - Intronic
1142302844 16:89268728-89268750 CTTGGCCCTGCTGGCAGCTGAGG - Intronic
1203051239 16_KI270728v1_random:876128-876150 CTGTGTGCTGCTCTCTGCTGAGG - Intergenic
1142957691 17:3532532-3532554 CTGGGACCTTCTCAAGGCTGAGG + Intronic
1144234218 17:13241575-13241597 CTGGGACTTGCCCTCGTCTGGGG + Intergenic
1144296525 17:13880414-13880436 CTAGGACCTGAACTCAGCTCTGG + Intergenic
1147804906 17:43124521-43124543 CAGTGACCTGCTCTCATCTCTGG + Intronic
1148070373 17:44905222-44905244 CTGGGACCTGATCTGAGAAGTGG + Exonic
1150719879 17:67605241-67605263 TTGGCACTTGATCTCAGCTGAGG - Intronic
1151449347 17:74188332-74188354 CTGGGACTGGGTCTCATCTGAGG + Intergenic
1152634347 17:81424374-81424396 CTTGGAGCTGCCCACAGCTGTGG + Intronic
1152928759 17:83099656-83099678 CTGGGTCCTGCCCCCACCTGAGG + Intergenic
1153532260 18:6059040-6059062 CTGACACCTGCCGTCAGCTGAGG - Intronic
1155149757 18:23113674-23113696 CTGGCACCAGCTTGCAGCTGAGG - Intergenic
1156227165 18:35120492-35120514 CTGTAATCTGCTCTGAGCTGAGG - Intronic
1157793567 18:50555295-50555317 AGGGGACCTACTCTCATCTGGGG - Intergenic
1159088249 18:63818629-63818651 CTTGGACCTGCAGTCTGCTGGGG + Intergenic
1159117621 18:64133521-64133543 CTGTGGCCTCCTCACAGCTGGGG - Intergenic
1160662337 19:306888-306910 CTGGCACCTGCTCCCATTTGTGG + Intronic
1161506792 19:4648490-4648512 CCGGGACCTGCTGACACCTGGGG - Intronic
1161541854 19:4856636-4856658 CTGTGCCCTGGTCCCAGCTGGGG + Intronic
1162153246 19:8660085-8660107 TTGGGACCTGCTCACAGTTCAGG + Intergenic
1162455223 19:10779988-10780010 CTGGCATCTACTCTAAGCTGCGG + Intronic
1163098391 19:15078024-15078046 CGGGGACCTGCTGTTAGGTGAGG - Intergenic
1163204088 19:15789603-15789625 CAGGGTCCTTCTCCCAGCTGAGG - Intergenic
1163233198 19:16017407-16017429 CTGGGCCATGCTCTCAGCCCTGG + Intergenic
1163420356 19:17210637-17210659 CTGGGATCTGCTCACACCTCCGG + Intronic
1163894434 19:20045335-20045357 GTGGGTCATTCTCTCAGCTGAGG - Intergenic
1164126773 19:22325573-22325595 CTGTGCCCTGCTTTCAGGTGGGG + Intergenic
1165921085 19:39298219-39298241 CTGGGCCCTGCTGTGGGCTGAGG - Exonic
1166720046 19:44991390-44991412 ATGGGGCCTGCTCTCTCCTGGGG - Intronic
1167300201 19:48673462-48673484 CTGGAACCTTTTGTCAGCTGTGG + Intergenic
1168322276 19:55517612-55517634 CTGGGACCTGCTCTGAGGTAGGG - Exonic
1202714033 1_KI270714v1_random:32609-32631 CTGGGACTTGAACTCAGCTGTGG - Intergenic
925180337 2:1813361-1813383 CTGGGGCCATTTCTCAGCTGTGG - Intronic
926315015 2:11703262-11703284 CTGGGAGCTGCTGCCTGCTGGGG + Intronic
926424058 2:12725418-12725440 CTGGGGCGTGCTCTCACCTCTGG - Intronic
926801348 2:16663693-16663715 CTTTGCTCTGCTCTCAGCTGGGG + Intronic
927960446 2:27237833-27237855 ATGAGACCTTCTCTGAGCTGCGG + Exonic
929140982 2:38666368-38666390 CTGGGGCCTGCTCGCAGCCCAGG - Intronic
929688250 2:44053185-44053207 AAGTGATCTGCTCTCAGCTGAGG + Intergenic
929960163 2:46490423-46490445 CAGGGCCCTGCTCTCAGTGGGGG - Intergenic
930957190 2:57217167-57217189 CTGGCACCTGCTCTGATCTTGGG + Intergenic
931152899 2:59595062-59595084 CTGGGACCTGCTCACAGAATTGG - Intergenic
933646040 2:84813457-84813479 AAGGGAGCTGCTCACAGCTGGGG - Intronic
934157078 2:89213313-89213335 CTGAGAACTGCTGTCAGCAGAGG + Intergenic
934251481 2:90359627-90359649 CTGGGACCAGCCCTCACCTTGGG - Intergenic
934258078 2:91443771-91443793 CTGGGACCAGCCCTCACCTTGGG + Intergenic
934985387 2:98881289-98881311 CTCCGACCTGCTCCCAGGTGGGG - Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935523203 2:104135249-104135271 CTGGGACCTGCTGTCGGGTGGGG + Intergenic
937426693 2:121805890-121805912 CTGGGCCCTGATCAAAGCTGAGG + Intergenic
938706898 2:133939372-133939394 CCGGGACCTGTTGTCAGGTGGGG + Intergenic
938732277 2:134155917-134155939 TGGGGATCTGCTCTCAGCTGAGG - Intronic
943425805 2:187732150-187732172 CAGGGACCTGCCCACACCTGGGG + Intergenic
944760458 2:202808500-202808522 CTGGGATCTGCTCTAGGCTGGGG + Intronic
945803658 2:214464738-214464760 CTGGGACCTGCTCTGGGCCAGGG - Intronic
945928378 2:215829338-215829360 GTGGGATTTGCTCTCAGCGGGGG + Intergenic
946403092 2:219479069-219479091 CTGGGACCTGCCCTGAGCGCTGG + Intronic
947327216 2:228992147-228992169 CAGGGGCCTCCTCTCTGCTGAGG - Intronic
948219839 2:236260854-236260876 TTGGGAACTGCTTTCTGCTGGGG - Intronic
948825702 2:240572659-240572681 CTGTGGCCTGCTGGCAGCTGGGG - Intronic
948887281 2:240890580-240890602 GTGTGAGCTGCTCTGAGCTGTGG - Intronic
948946571 2:241223564-241223586 CCGGCACCTGCTCCCAGCTGTGG - Intronic
949066310 2:241992928-241992950 TTGGGAACTGGTCCCAGCTGGGG - Intergenic
1168923249 20:1558453-1558475 CTGGGACCAGCTCTCAGAGATGG + Exonic
1169028129 20:2386780-2386802 CTGGGAGCTGCTTTGGGCTGTGG + Intronic
1169065108 20:2690779-2690801 CTGGGACCTCCTGGCAGCAGTGG - Intergenic
1169643806 20:7786485-7786507 CTGGGGCCTGTTGTCAGGTGGGG + Intergenic
1170293156 20:14793712-14793734 CTGAGACCTCCACCCAGCTGGGG + Intronic
1170581024 20:17699778-17699800 CTGGGTGCTGTTCTCAGCTGGGG - Intronic
1170969070 20:21101828-21101850 CTGGCCCCTGCACTCAGCTAGGG - Intergenic
1171229213 20:23469012-23469034 CTGGGCCCTGTTCTAAACTGGGG + Intergenic
1173525755 20:43731323-43731345 CTGGCACCTGCTCTGAGCCTGGG + Intergenic
1173642540 20:44614074-44614096 CTGGGACCTGATCAAGGCTGGGG - Intronic
1174060163 20:47826877-47826899 CCGGGGCCTGCTCCCAGGTGGGG - Intergenic
1174071730 20:47904492-47904514 CCGGGGCCTGCTCCCAGGTGGGG + Intergenic
1174152318 20:48494143-48494165 CCGGGGCCTGCTCCCAGGTGGGG - Intergenic
1174683857 20:52434646-52434668 CTGGTGCCTGCTTGCAGCTGAGG + Intergenic
1175148184 20:56912311-56912333 CAAGGACGTGGTCTCAGCTGAGG - Intergenic
1175785202 20:61707876-61707898 CTGTGTCCTGATCTCAGCTCGGG + Intronic
1178476050 21:32938275-32938297 CTCGGACCTGCTGTGACCTGTGG + Intergenic
1178905260 21:36631223-36631245 CTGGGAGCTGCTGGAAGCTGGGG + Intergenic
1179171935 21:38979951-38979973 CTGGGGGCTGCTCCCAGGTGTGG - Intergenic
1179438148 21:41376027-41376049 CTGTGGCCTGCACTCAGATGAGG - Intronic
1179465346 21:41568063-41568085 CTGGGATCTGCCCTCCTCTGAGG + Intergenic
1179524198 21:41965229-41965251 ATGGGACCTGAACTCAGCAGAGG + Intergenic
1179908540 21:44436319-44436341 CTGGGACCTCCCCCCAGCGGAGG + Intronic
1181094652 22:20496801-20496823 ATGGGACCTGCTCGAAGGTGAGG - Intronic
1181403643 22:22666990-22667012 CTGGGACCAGGTGTCAACTGGGG + Intergenic
1181582371 22:23835363-23835385 ATGGGACCTGCCAACAGCTGAGG - Intronic
1181757164 22:25032136-25032158 CTGGGGGCTGCTCTGAGGTGGGG + Intronic
1182026717 22:27124832-27124854 CTGAGCAATGCTCTCAGCTGGGG - Intergenic
1182350160 22:29694928-29694950 CTGGGCTCTTCACTCAGCTGGGG - Exonic
1182842385 22:33401897-33401919 CTGGTACCAGCTCTCAGCTTTGG + Intronic
1183026144 22:35067100-35067122 GTGGGCCCTGCTCTCTGCAGGGG + Exonic
1183465201 22:37976682-37976704 CTGGGCTCAGATCTCAGCTGTGG - Intronic
1183931403 22:41237994-41238016 CTGGGACCTGCGCTGCCCTGGGG - Exonic
1184158350 22:42683631-42683653 CTGGGAGCTGCTGTGGGCTGGGG + Intergenic
1184171196 22:42760852-42760874 CTGGGACCTTCTCTGATCTGAGG + Intergenic
1184674392 22:46032543-46032565 CTGGGCCCTTTTCTCAGGTGTGG - Intergenic
1184691142 22:46117845-46117867 CTGGGTCCTGCTCCCAGCCCTGG - Intergenic
950502755 3:13374818-13374840 CTGGCACCGGCTCTCTGCTCAGG - Intronic
954536555 3:51363640-51363662 CTGGGGCCTGTTGTCAGGTGGGG - Intronic
954799029 3:53176293-53176315 CTGGGTCCTGCTCTCTGCTTTGG + Intronic
955402670 3:58604349-58604371 CCAGGACATGCTCTGAGCTGAGG - Intronic
956358570 3:68420570-68420592 CTGGGACTAGTTCTCAACTGGGG + Intronic
956861284 3:73326551-73326573 CAGGCACATGTTCTCAGCTGAGG + Intergenic
957966144 3:87324090-87324112 CTGGTACATGCTCTCAGCCTTGG - Intergenic
959108346 3:102092092-102092114 CTGCACCCTGCTCTGAGCTGCGG - Intergenic
959542813 3:107559326-107559348 CTGGGACCTGCTCTCAGCTGAGG + Intronic
960003873 3:112762190-112762212 TTGGGCCCTGATCTCATCTGTGG - Intronic
961322356 3:126084346-126084368 CCGGGCCCTCCTCGCAGCTGGGG + Intronic
961477579 3:127158288-127158310 CGGGCACATGCTCTCAGATGGGG - Intergenic
961551913 3:127674258-127674280 CTGTCACCTGCCCTCACCTGGGG + Intronic
961755351 3:129123667-129123689 GTGGTAGCTGCTCTGAGCTGGGG - Intronic
961807859 3:129502162-129502184 GTGGGGCCTGCTCTGAGCTCTGG - Intronic
962827216 3:139108687-139108709 CTGGTCCCTGCTCACTGCTGTGG - Intronic
964413279 3:156421741-156421763 CCAGGACCTGGTCTCAGATGAGG + Intronic
964673808 3:159255394-159255416 ATGAGACCTGTTCTCAGGTGTGG + Intronic
966670517 3:182520894-182520916 CTGGGACCATCTCTCTGATGCGG - Intergenic
967129855 3:186460410-186460432 CTGGGATTTCCTCTCACCTGTGG + Intergenic
967576946 3:191105474-191105496 CTGGCTCCTTCTCTCACCTGGGG + Intergenic
968647412 4:1747639-1747661 CTGAGCCCTGCCCTGAGCTGTGG - Intergenic
968966299 4:3770655-3770677 GTGGGGTCTGCCCTCAGCTGTGG - Intergenic
969173580 4:5383130-5383152 CTGGGCCCTGCAGTCAGCCGTGG + Intronic
969632125 4:8345031-8345053 CTGGATCCTTCTCTCTGCTGTGG - Intergenic
969858637 4:10019137-10019159 CTGGAACGTTCCCTCAGCTGGGG + Intronic
970655144 4:18222837-18222859 CTGGGACTTGAACTCAGCTCTGG - Intergenic
970857534 4:20666384-20666406 CTGTGAACTGCTCTCAGATTTGG + Intergenic
971660391 4:29407149-29407171 ATGAGACCTACTCTCAGCAGAGG + Intergenic
972157996 4:36188723-36188745 CTGGGACCTGCTCAAAAGTGTGG - Intronic
974775753 4:66478241-66478263 CCGGGACCTGTTGTCAGGTGGGG - Intergenic
976152014 4:82101765-82101787 CTGGGACTTGCCCTTGGCTGCGG - Intergenic
977412691 4:96688450-96688472 CCAGAACCTGCTCTCAACTGGGG - Intergenic
977928704 4:102729324-102729346 CTGGTACATGCTCTCAGCCTTGG + Intronic
980877445 4:138676277-138676299 CTGAGACATGGTCTCAGGTGGGG + Intergenic
980930473 4:139178140-139178162 CTGGGCCCAGCGCGCAGCTGCGG + Intergenic
981362444 4:143863069-143863091 CTGGGAATTGCCCTCAGCAGAGG - Intergenic
981373173 4:143983837-143983859 CTGGGAATTGCCCTCAGCAGAGG - Intergenic
981382270 4:144087111-144087133 CTGGGAATTGCCCTCAGCAGAGG - Intergenic
981748225 4:148070855-148070877 CTGGGGCCTGCTCACAGCTGGGG + Intronic
983954087 4:173676739-173676761 GTGGGAGCTGCTCTCAGCAATGG + Intergenic
984427658 4:179608531-179608553 CTGGGCCATTCTCTCTGCTGAGG - Intergenic
986286450 5:6362735-6362757 CTGGGGGCTTCTCTCAGCTGGGG - Intergenic
986309815 5:6543618-6543640 CAGGGACCTGCCCTCTGCCGTGG + Intergenic
988494516 5:31733583-31733605 GAGGCACATGCTCTCAGCTGGGG + Intronic
991703139 5:69333965-69333987 CTGGGTGCAGCTCTCATCTGAGG - Intergenic
991959657 5:72031599-72031621 CTGGTATCTCCTCTCACCTGAGG + Intergenic
996241447 5:121208119-121208141 CTGGGGCCTGCTGTCGGGTGGGG - Intergenic
996432944 5:123401494-123401516 CTGGTACATGCTCTCAGCCTCGG + Intronic
996525763 5:124477776-124477798 CTGAGGCCTTCTCCCAGCTGAGG - Intergenic
997412764 5:133702778-133702800 CTGGAATCTGCTCTCAGCTCTGG - Intergenic
997582438 5:135026364-135026386 GAGGGCCCTGGTCTCAGCTGAGG - Intergenic
997751510 5:136350669-136350691 CTGGGTCTTGCTCTCAGGTATGG + Intronic
998325651 5:141277727-141277749 CTGGGATCTGCTCACTTCTGAGG - Intergenic
998394299 5:141808595-141808617 CTAGGCCCTCCTCTCATCTGGGG - Intergenic
998857786 5:146410475-146410497 CTGGGCCTTGCTCTCAGCTGAGG + Intergenic
999070339 5:148737444-148737466 CTGGGTCCTGTTCTCAGCCGTGG - Intergenic
1000296126 5:159915221-159915243 CTGGGAACTGAACTCAACTGTGG - Intergenic
1000979169 5:167798383-167798405 CAGGAACTTGCTCTCTGCTGTGG - Intronic
1001083191 5:168681782-168681804 CTGAGCCCTGCCCTGAGCTGGGG - Intronic
1001396606 5:171422695-171422717 CTGGGGCCTGCTCCCTGCTGAGG + Intronic
1001426489 5:171625940-171625962 GGGGCACCTCCTCTCAGCTGGGG - Intergenic
1001991015 5:176115398-176115420 CTGTGTGCTGCTCTCTGCTGAGG - Intronic
1001997454 5:176173725-176173747 CTGTGTGCTGCTCTCTGCTGAGG + Intergenic
1002225857 5:177722742-177722764 CTGTGTGCTGCTCTCTGCTGAGG + Intronic
1002267992 5:178048470-178048492 CTGTGTGCTGCTCTCTGCTGAGG - Intronic
1002306181 5:178285205-178285227 CATGGACCTGGTTTCAGCTGAGG + Intronic
1003646325 6:7915563-7915585 CTGGCACCTTCTCTCACATGCGG + Intronic
1006348004 6:33498516-33498538 CTAGGGCCTCCTCTCTGCTGAGG + Intergenic
1006644452 6:35506216-35506238 CTGGGACCTGCTGGGAGCGGGGG - Intronic
1006812118 6:36826784-36826806 CTTGCACTTCCTCTCAGCTGTGG + Intronic
1007950625 6:45868990-45869012 ATGGGACCTGCTCATATCTGTGG - Intergenic
1008836832 6:55842587-55842609 CTGGCTGCTGCTCTCAGCTGAGG + Intronic
1010176255 6:73031543-73031565 CTAGGGCCTGCTCTAAGCAGAGG + Intronic
1011257500 6:85438049-85438071 CTGGGACCTGTTTTGAGGTGGGG - Intergenic
1014289313 6:119539931-119539953 CTAGGGCCTCCTCTCTGCTGAGG + Intergenic
1016516095 6:144894540-144894562 CTGGGACTTCCTCCCAGCAGAGG + Intergenic
1017313945 6:153007000-153007022 CTGGGACCTTCTATCACCTAGGG + Exonic
1017909832 6:158783206-158783228 CTGGTACCTGCAGGCAGCTGGGG + Intronic
1018705829 6:166462478-166462500 CTGTGACCTCCTCTGGGCTGAGG + Intronic
1018810143 6:167293182-167293204 CAGGCAGCTGCTCACAGCTGCGG - Intronic
1018965721 6:168487226-168487248 CTGTGTTCTGATCTCAGCTGCGG + Intronic
1019294622 7:267175-267197 CGGGAACCTGCGCTCACCTGCGG - Intergenic
1019309354 7:352712-352734 CTTGGCCCTGTACTCAGCTGAGG + Intergenic
1019449281 7:1088439-1088461 CTGGGTGCTGCTCTCACCAGGGG - Intronic
1021801008 7:24306409-24306431 CTGGGAATTACCCTCAGCTGAGG + Intergenic
1022207982 7:28180852-28180874 CTGGTCCCTCCTCCCAGCTGCGG - Intergenic
1023758188 7:43439776-43439798 CAGGTACTTGCTTTCAGCTGGGG - Intronic
1023760541 7:43461617-43461639 CTGTGATCTTCTCTCTGCTGAGG - Intronic
1023760806 7:43463717-43463739 CTGGGGCTTGCTCGCAGCTTTGG - Exonic
1024804019 7:53114888-53114910 CTGGCTCCTGCCTTCAGCTGGGG + Intergenic
1025097074 7:56104446-56104468 CTGGGTGCAGCTCTCATCTGAGG + Exonic
1025234761 7:57227144-57227166 CCGGGGCCTGCTCCCAGGTGGGG + Intergenic
1025478770 7:60957426-60957448 CCGGGACCAGCCCTCAGCTTGGG + Intergenic
1029307469 7:99630652-99630674 CTGGGAGCAGATCCCAGCTGGGG - Exonic
1030059401 7:105610915-105610937 CTGGGAGCTTCACTCAGCAGAGG + Intronic
1030735982 7:113049219-113049241 CTGGGACCTGCTGGTAGCTGGGG - Intergenic
1033290450 7:140078526-140078548 CTCTCACCTGCTCTCACCTGAGG + Intergenic
1034076065 7:148232147-148232169 CTGGGACCTGCCCACCACTGAGG + Intronic
1034979101 7:155464931-155464953 CTGGCACCTGCTCCCAGGCGGGG - Intergenic
1035276495 7:157751075-157751097 CGGGGAGCTGCTGTGAGCTGTGG + Intronic
1035351703 7:158251983-158252005 CTGGGACCTGCCCTGAGCCTGGG - Intronic
1035527696 8:326624-326646 CTAGAACCTACTGTCAGCTGAGG + Intergenic
1037825800 8:22159960-22159982 CTGGCACCTGCACACAGCTGAGG + Intronic
1038464779 8:27751543-27751565 CTGGTACCTGTTATCAGCTGTGG + Intronic
1039632530 8:39128044-39128066 ATGGGACCTGAACTCAGCTCTGG - Intronic
1039781961 8:40794771-40794793 CTGGGTCTTTGTCTCAGCTGGGG + Intronic
1039964457 8:42273693-42273715 ATGGGACCTGGCCTCAGCTGAGG + Intronic
1044693483 8:94900659-94900681 CGGGGCCCTGCTCTCCACTGAGG + Intronic
1044721570 8:95154665-95154687 CTATGACCTGCTTTCTGCTGGGG + Exonic
1045474749 8:102543297-102543319 CTGGGACCTGCTCTCCAATGAGG - Intergenic
1045863271 8:106837017-106837039 CTGAAACCTCCTCCCAGCTGTGG - Intergenic
1046407236 8:113790554-113790576 CTGGTCCCTGGTCCCAGCTGTGG - Intergenic
1047228413 8:122975661-122975683 ATGGCCCCTGCTCTCAGCTTGGG - Intergenic
1048470346 8:134699172-134699194 GTTTGACCTGCTCTCAGGTGTGG - Intronic
1048935765 8:139355418-139355440 CTGGGCCCGGCTGTCACCTGAGG - Intergenic
1048967107 8:139623382-139623404 CTGGGACCTGCTCTTGGCACAGG + Intronic
1049671398 8:143871702-143871724 CTGGGAGCTGCTCTTCTCTGAGG - Exonic
1049758371 8:144320771-144320793 CTGGCCCCTTCCCTCAGCTGTGG - Intronic
1051336584 9:16071181-16071203 CTGAGACCTAATCACAGCTGAGG + Intergenic
1051615423 9:19001056-19001078 CTGGGACTTGAACTCAGCTCTGG + Intronic
1053061711 9:35036913-35036935 CTGAGACCTGCTGGCTGCTGGGG + Intergenic
1053208731 9:36209699-36209721 CTGCCACCTGCTCCCAGGTGGGG - Intronic
1055741186 9:79391361-79391383 CTGGGTGCAGCTCTCATCTGAGG - Intergenic
1056214398 9:84393823-84393845 CTGGGACCTGCTCCCTGCTTTGG + Intergenic
1056338898 9:85604032-85604054 CTGGAACCTGCCCTGGGCTGAGG + Intronic
1057353709 9:94319284-94319306 CTGGGCCCTGCTCACACCTGGGG - Intronic
1057654041 9:96938308-96938330 CTGGGCCCTGCTCACACCTGGGG + Intronic
1058573856 9:106379135-106379157 CTGGGAACTGGACTCAGCTGGGG - Intergenic
1058666544 9:107322645-107322667 CTGGAACCTGCGGTCAGCTTAGG + Intronic
1059163958 9:112061180-112061202 CTGGGACCAAGTCTCTGCTGAGG - Intronic
1060803046 9:126556827-126556849 CTGGGACCTTCTCTCCCCTTAGG + Intergenic
1060825523 9:126685523-126685545 CTGGGAGTTGCCCTAAGCTGTGG + Intronic
1060980313 9:127788121-127788143 CTGGGTCCTCCTCCCAGCTCTGG - Intronic
1061264482 9:129497318-129497340 TGGGGGGCTGCTCTCAGCTGGGG - Intergenic
1061417033 9:130452644-130452666 CTGGGACCTGCTGCCAGCCCTGG + Intronic
1061569763 9:131469981-131470003 CGGGGACCTGGTCTCGTCTGGGG + Intronic
1062267445 9:135693753-135693775 CAGTGGACTGCTCTCAGCTGGGG + Exonic
1062375189 9:136258954-136258976 CCGAGACCTGCACTGAGCTGTGG + Intergenic
1062463808 9:136672546-136672568 CTCGTACCTTCCCTCAGCTGAGG - Exonic
1203384606 Un_KI270438v1:12220-12242 CTGTGCCCTGCTCTCAGATGTGG - Intergenic
1186463261 X:9765301-9765323 TTGGGACCTGCTCAGTGCTGGGG - Intronic
1187021891 X:15392107-15392129 CTGGGAGCTGGGCTCTGCTGGGG - Intronic
1187434458 X:19254338-19254360 CTCATTCCTGCTCTCAGCTGGGG - Intergenic
1187498310 X:19814938-19814960 CTTGGACCTGCTCAAAGCTGGGG + Intronic
1189205867 X:39238337-39238359 CTCGGAGCTTCTCTCAGCTGGGG - Intergenic
1189682818 X:43534506-43534528 CTGGGAATTGCCCTCTGCTGAGG - Intergenic
1189772110 X:44437278-44437300 CTGGGGATTGCTGTCAGCTGAGG - Intergenic
1192234102 X:69285316-69285338 CTGGGGCCTGATCCCAGCTCCGG - Intergenic
1193588768 X:83361849-83361871 CTGGGGCCTGTTGTCAGGTGGGG - Intergenic
1194603361 X:95950853-95950875 CAGGGACCTGCTCACCACTGTGG + Intergenic
1195432103 X:104800752-104800774 CAGAGGCCTGCTCTCTGCTGGGG - Intronic
1196961814 X:121011610-121011632 CTTGGACCCCCTCTCTGCTGTGG + Intergenic
1199860307 X:151795375-151795397 CTAGGACCTGCTTTCTGGTGGGG - Intergenic
1200081925 X:153581500-153581522 CTCGGACCTGTGCTCAGCTGAGG - Exonic
1200901322 Y:8434990-8435012 CTGGGACCAGCACCCAGCCGAGG - Intergenic
1202252262 Y:22885455-22885477 CTGGGACCAGCACCCAGGTGAGG - Intergenic
1202405251 Y:24519204-24519226 CTGGGACCAGCACCCAGGTGAGG - Intergenic
1202465529 Y:25150878-25150900 CTGGGACCAGCACCCAGGTGAGG + Intergenic