ID: 959543129

View in Genome Browser
Species Human (GRCh38)
Location 3:107563284-107563306
Sequence AATCTGCAAGGAGCTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959543129_959543134 8 Left 959543129 3:107563284-107563306 CCCTGTGAAGCTCCTTGCAGATT 0: 1
1: 0
2: 0
3: 15
4: 153
Right 959543134 3:107563315-107563337 ATCTCACAGAGCCAGACTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959543129 Original CRISPR AATCTGCAAGGAGCTTCACA GGG (reversed) Intronic
900397497 1:2459147-2459169 CATCCGCCAGGAGCTTCACTGGG + Intronic
902882324 1:19380654-19380676 AGTATGCAAGTAGCTACACATGG - Intronic
906561578 1:46761891-46761913 AATGTGGCAGGAGCTACACAAGG - Intronic
907019140 1:51048249-51048271 AATCTATAAGGAACTTAACAAGG - Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
908718391 1:67095728-67095750 ATTCTGGAAGAAGCTCCACAGGG + Intronic
912646865 1:111401393-111401415 GATCAACATGGAGCTTCACACGG + Intergenic
915015356 1:152727988-152728010 AATATGCAAGGAGGAACACAAGG - Intergenic
918435494 1:184507432-184507454 AATCTGGAAGAAGCTTAACTAGG - Intronic
923100199 1:230808175-230808197 ATACTGCAAGCTGCTTCACAAGG + Intergenic
1063136370 10:3219887-3219909 AAACTTCAAGCACCTTCACAAGG - Intergenic
1064636299 10:17371312-17371334 AATCTGCAAAGAGGTTCAGGTGG + Intronic
1066668575 10:37812616-37812638 AATATCAAAGGAGCTTCAAAAGG - Intronic
1068366278 10:56054684-56054706 AATCTGAAATGAGCTTCAGAAGG - Intergenic
1068664031 10:59653548-59653570 AATCTGCATGGAACATCTCATGG - Intronic
1070731593 10:78832197-78832219 AATATTCAAGGAGTTCCACAAGG + Intergenic
1071858498 10:89649239-89649261 AAACTGCCAGGAGTTCCACAAGG + Intergenic
1076549333 10:131267803-131267825 AGTCTGCAAGGAGGTGGACAGGG - Intronic
1076637346 10:131891208-131891230 AATCTCAAAGCAGCCTCACAGGG + Intergenic
1078008897 11:7554990-7555012 AATTTGCAAGCAGAATCACAGGG - Intronic
1078457696 11:11488197-11488219 AATCTGCAATGGGTTTCACTGGG + Intronic
1084078992 11:66806370-66806392 TATATGCTAGGAGCTTCACATGG - Intronic
1084497091 11:69511465-69511487 GATCTGTAGGGAGCTACACAGGG + Intergenic
1085746326 11:79117625-79117647 AATGTGCCAGGAGCTACACTTGG - Intronic
1087930551 11:103972975-103972997 TATGTGCAAGGAACTTCACCAGG + Intronic
1090432028 11:126654128-126654150 TATCTGCATTCAGCTTCACAAGG + Intronic
1091641568 12:2241104-2241126 AAGCTGCCAGGAGCCTCGCAAGG - Intronic
1091775173 12:3179971-3179993 TTTCTGCAAGGAGCTGCACCTGG - Intronic
1091915232 12:4268504-4268526 AATTTACAAGGAGCTTCAGTGGG - Intergenic
1093337622 12:17926357-17926379 AATCTACAAGGAACTCAACAAGG + Intergenic
1094828077 12:34287445-34287467 AAGCTGCAAGGAGATGCATAAGG + Intergenic
1101473600 12:105022297-105022319 ATTCTGCAAGTATCTTCAAAGGG - Exonic
1102403793 12:112654598-112654620 AATCTGCAAGAAGATACTCAAGG - Intronic
1103420868 12:120781122-120781144 AGTCTGCTAGGTGCTTTACATGG - Intronic
1105292821 13:19063253-19063275 AATCTCCAAGCAGGTTTACAAGG - Intergenic
1106945553 13:34823848-34823870 ATTCTGCAAATAGCTTCCCAAGG + Intergenic
1107261439 13:38496190-38496212 AATCTGGAAAGATATTCACAAGG + Intergenic
1110147110 13:72205133-72205155 AAACTGGAAGGATCATCACACGG + Intergenic
1112329220 13:98464087-98464109 ACTCTGCACAGAGCTTCACAGGG + Intronic
1112786648 13:102958454-102958476 ATTCTGCATGGAGTCTCACAAGG - Intergenic
1114204057 14:20551559-20551581 AATTTTCAAGGAGCAGCACAGGG + Intergenic
1115569180 14:34650973-34650995 AGTCTGAAATGAGCTTCACAGGG + Intergenic
1118040079 14:61906854-61906876 GATGTGCCAGGAGCTCCACAAGG + Intergenic
1118426402 14:65668334-65668356 AATCTATAAGGAACTTAACAAGG + Intronic
1119168449 14:72514863-72514885 AAGCTTCAAGGGGCTTCCCATGG + Intronic
1119229225 14:72967443-72967465 ACTATGCTAGGAGCTTTACATGG - Intergenic
1119653539 14:76400374-76400396 AATCTGCAACGGTCTTCAGATGG - Intronic
1119873988 14:78041163-78041185 AATCTGGGAGCAGCTTCACTGGG - Intergenic
1121698865 14:95936505-95936527 AATCCCCAATGAGCTTCCCAAGG + Intergenic
1128901695 15:71428368-71428390 ATTCTGCAAGGATGTGCACAGGG - Intronic
1128978054 15:72167610-72167632 AACCAGCAAGGGGCTTCACCCGG + Intronic
1129674776 15:77626630-77626652 AATCTCTAAGGAGCTTATCAAGG + Intronic
1129968190 15:79755479-79755501 ACTATGCTAGGAGCTTTACATGG - Intergenic
1130288535 15:82575631-82575653 AATCTGAAAAGCACTTCACAAGG + Intronic
1131354408 15:91732247-91732269 ATTCAGCAAAGAGCTTTACATGG + Intergenic
1134059369 16:11189727-11189749 AATCTGCCAGGATGTCCACAAGG - Intergenic
1134280519 16:12812852-12812874 AATCTGCAAGGTGGTCCAGACGG - Intergenic
1134868465 16:17630107-17630129 GAACTGCAAGTAGCTTCATACGG - Intergenic
1136968516 16:34944063-34944085 CATCTGCCAGGAGCTTCTCAAGG - Intergenic
1138228349 16:55318983-55319005 AATGTGCCAGGACTTTCACAAGG - Intergenic
1144592221 17:16534314-16534336 AATCTGCAATCAGTTTCACTGGG + Intergenic
1146289738 17:31598703-31598725 AATGTGCAAGGAGCTCCAGAGGG + Intergenic
1146823472 17:36003037-36003059 AATCTGCCAGTGGCTTCTCATGG + Intergenic
1149009906 17:51845472-51845494 AATTTGGAAGCAGCTTCACTGGG - Intronic
1149017859 17:51929737-51929759 ATTCTGCAAGGAGCTTGTCATGG - Intronic
1154275302 18:12954236-12954258 AATTTGCTAGGTGCTTCTCAGGG - Intronic
1156134171 18:34016514-34016536 TATTTGCAAGGAGCTTAGCATGG - Intronic
1156277999 18:35603278-35603300 AATCTGCTAGGCACTGCACATGG - Intronic
1158683966 18:59595996-59596018 TATCTACAAGGTGCTCCACATGG + Intronic
1158833886 18:61309847-61309869 ATCCTGCACGGATCTTCACATGG - Intergenic
1159240147 18:65731920-65731942 CATCTCCAAGGAGCTTCATAGGG - Intergenic
1159407578 18:68024906-68024928 AATCACCAAGGAGAGTCACAAGG - Intergenic
1160564915 18:79781050-79781072 AATGTGCAATAAGCTTCATAGGG - Intergenic
1165614445 19:37187114-37187136 AATTTGGAAAGAGCTTCACCTGG - Exonic
1166604820 19:44131741-44131763 AATGTGGAAAGAGCTTCAGATGG + Exonic
1167457252 19:49603187-49603209 AATGTGCAAGGCACTTGACAGGG + Intronic
924967191 2:88864-88886 GATCAGAAAGCAGCTTCACATGG + Intergenic
927219777 2:20696245-20696267 AATCTGCAAACAACTGCACAAGG + Intronic
929155042 2:38781523-38781545 CATCTTCAAGGAAGTTCACAAGG - Exonic
929309131 2:40401513-40401535 ACTATGCAAGGAGCTTTACTAGG - Intronic
932364427 2:71139588-71139610 AAACTTCAGGGAGCATCACAAGG + Intronic
933673849 2:85035507-85035529 CTTCTACAAGGAACTTCACAAGG + Intronic
935581888 2:104762923-104762945 ATTCTGCAATGATCATCACAGGG - Intergenic
936927757 2:117755049-117755071 AATCTGCAAGGAGATTAGTATGG - Intergenic
937719965 2:125082591-125082613 AATCTCCAAGGAACAACACATGG - Intergenic
937764947 2:125650238-125650260 AAACTGCAAGGGGCTTGATATGG - Intergenic
938509193 2:131922616-131922638 AATCTACAAAGAGCTTTACATGG + Intergenic
938873711 2:135510524-135510546 AATCTTCATGGATCTTCACGCGG - Intronic
940641259 2:156346690-156346712 TATCTGGAAGAAGCTTCAAAGGG + Intergenic
941226016 2:162849129-162849151 AGGCAGCAAGGACCTTCACAAGG + Intergenic
941733210 2:168943143-168943165 AATCTGCAAGGAGCTTTTGAAGG - Intronic
944014931 2:195024640-195024662 AAAGTGCAAAGAGTTTCACAAGG + Intergenic
944881541 2:204017900-204017922 TATTTGCAAGGATCTTCAGAAGG + Intergenic
946731511 2:222714223-222714245 AATCTGCATGAAACTTCACTAGG - Intergenic
948834124 2:240616396-240616418 AGTCTGCAGGAAGCTGCACAGGG - Intronic
1168844548 20:934943-934965 TATCTGCCAGCAGCTACACAAGG - Intergenic
1168918355 20:1510072-1510094 CTACTGCCAGGAGCTTCACAGGG + Intergenic
1172974946 20:38899285-38899307 ATTCTGCTAGGAGCATCAGATGG + Intronic
1173538333 20:43832566-43832588 AATCTGCTTGGAGTTTCACGGGG + Intergenic
1177112783 21:17049056-17049078 AATCTTCAAGGAAATTCAAAAGG - Intergenic
1177982341 21:27929785-27929807 AATCTACAAAGAGCTTTACATGG - Intergenic
1180154700 21:45972328-45972350 ACTCTGCAGGGAGCTGAACATGG - Intergenic
1181477763 22:23179485-23179507 AACCTGCACTGAGGTTCACAGGG - Intergenic
1182809713 22:33105509-33105531 AAACTGCGAGGAGCTTCCCGAGG + Intergenic
1184302710 22:43571840-43571862 AAACTGCAAGGAACATGACATGG - Intronic
950269202 3:11600131-11600153 AATATGCAAAGAGCTTGGCATGG - Intronic
954453526 3:50584682-50584704 AATCTGAAATCAGTTTCACAGGG - Exonic
956034312 3:65073767-65073789 AGTCTGCAAGGAGTATCTCATGG - Intergenic
959543129 3:107563284-107563306 AATCTGCAAGGAGCTTCACAGGG - Intronic
962126317 3:132623129-132623151 AATATTCAAGGAGTTTCAAAAGG + Intronic
965804457 3:172527809-172527831 AATCTTCAAAAATCTTCACAGGG - Intergenic
967512323 3:190325986-190326008 AGACTCCAAGGAGCTTCAAAGGG - Intronic
967552123 3:190808827-190808849 GTTCTGCTAGGCGCTTCACATGG + Intergenic
968292316 3:197548175-197548197 TCTCTGCAAGGAGCTTTCCATGG - Intronic
968423007 4:500738-500760 AATGTTGAAGGAGCCTCACACGG + Intronic
969701762 4:8771486-8771508 AATCTGCAGGGAGCTGCTCCTGG + Intergenic
971115139 4:23637443-23637465 AATCATCAAGGAGATTCTCAAGG + Intergenic
971273139 4:25170387-25170409 AGTGTGCAAGGAGGTGCACAGGG - Intronic
977520394 4:98075395-98075417 AATCTTCCAGCAGTTTCACAGGG - Intronic
981157303 4:141454144-141454166 TATCTTCAAGGAGTTTTACAAGG - Intergenic
984959847 4:185086180-185086202 AGTCTGCAGGGAGCTGCAGATGG + Intergenic
985137733 4:186804425-186804447 AATCTGCAAGCACCTTGACAAGG + Intergenic
985251670 4:188030774-188030796 AAGCTGCAATGAACATCACAGGG - Intergenic
985768992 5:1797362-1797384 CCTCTGCAAGCAGCTTGACATGG - Intergenic
988037587 5:25848443-25848465 AATCTTCACTGAGATTCACAGGG + Intergenic
989024955 5:37056818-37056840 AAACTTCAAGGAATTTCACATGG + Intronic
989460759 5:41696234-41696256 AATCTACAGGGAGCTTCTCATGG - Intergenic
990568917 5:57057821-57057843 AATCTGAAATGAGTTTCACTGGG - Intergenic
991176143 5:63689497-63689519 AATCAGCAAGGAGCTCCAATGGG - Intergenic
991226579 5:64280181-64280203 AATCTGAAAGAAACTTAACAAGG - Intronic
994770928 5:103980956-103980978 AATCTAAAAGAAGCTACACACGG + Intergenic
998828206 5:146127695-146127717 AATCTGCAAGCAGATTCTAAAGG + Intronic
999806201 5:155083570-155083592 TATCTGCAAGGAGATTGATATGG - Intergenic
1002422997 5:179159371-179159393 TTTCTGCAAGTACCTTCACACGG - Intronic
1003759321 6:9158119-9158141 AATCTGCATGGGGATTCACATGG - Intergenic
1006249248 6:32766615-32766637 AATATGTAAGTAGCTTCACAAGG - Intergenic
1008779790 6:55089728-55089750 TATCTGCACGCATCTTCACATGG + Intergenic
1009764894 6:68059503-68059525 AATCTGTAGGGAGTGTCACAAGG - Intergenic
1011628617 6:89303107-89303129 CAGCTGCAAGCAGCTTCACTTGG - Intronic
1014788750 6:125647070-125647092 AATGTGCTAGGAGATTCTCAAGG - Intergenic
1015960940 6:138649042-138649064 AATCTTCAAGAAGCTGAACAAGG + Intronic
1016122319 6:140359170-140359192 AAACTACATGGAGCTGCACAGGG + Intergenic
1019213566 6:170424990-170425012 AATGTGCCAGAAGCTCCACAAGG - Intergenic
1022742881 7:33139999-33140021 AATCTACCAGAAGCTTAACAGGG - Intronic
1023118247 7:36883622-36883644 GGTCAGCGAGGAGCTTCACATGG - Intronic
1027720272 7:81732332-81732354 AATATGGAAGCAGCTTCAAAAGG + Intronic
1030738319 7:113077806-113077828 ACTCTGCTAAGGGCTTCACAAGG + Intergenic
1031910428 7:127511268-127511290 AGTCTGCAATGAGCCTTACAGGG - Intergenic
1032017537 7:128389440-128389462 AAGCTGAAAGGAGCCTCAGAGGG + Intergenic
1038676192 8:29624710-29624732 AAGCAACAAGGAGCTTCCCAGGG + Intergenic
1038881610 8:31619665-31619687 AGTTTTTAAGGAGCTTCACAGGG + Intergenic
1039279453 8:35967772-35967794 AATGGGCAAAGATCTTCACAGGG + Intergenic
1039356270 8:36820114-36820136 ATTCATCCAGGAGCTTCACAAGG - Intronic
1041571020 8:59336961-59336983 AATCTGAAATTAGCTTCACTGGG - Intergenic
1041754476 8:61299018-61299040 AATGGGCAAGGAGGCTCACAGGG - Intronic
1041768103 8:61441515-61441537 AATGTGAAAGAAGCTTCCCAAGG + Intronic
1042142244 8:65690854-65690876 TCTCTGCTAGGAGCCTCACAGGG + Intronic
1044175039 8:89109462-89109484 AAACAGTATGGAGCTTCACAAGG - Intergenic
1046101402 8:109617977-109617999 ATTGTGCAAGGAGCTACAGATGG - Intronic
1049261954 8:141644107-141644129 TTTCTCCAAGGAGCTTGACATGG + Intergenic
1057442846 9:95094503-95094525 AAGCTGCATGGTGCTTCCCAGGG - Intergenic
1057447099 9:95124225-95124247 AAACTGCGGAGAGCTTCACAGGG + Intronic
1060764435 9:126283210-126283232 AGTCTAAAAGGAGCTTTACAGGG - Intergenic
1061481922 9:130901679-130901701 AATGGGCACGGAGCTTGACATGG - Intergenic
1062146560 9:134992579-134992601 AATCTGTAAGGATGTTCACTTGG - Intergenic
1193406812 X:81110588-81110610 AATCTATAAGGAGCACCACACGG - Intergenic
1194023948 X:88727549-88727571 AATGTGCAAGCAGCTTTGCAGGG - Intergenic
1196055795 X:111353555-111353577 AATGTGAAAAGTGCTTCACAGGG - Intronic
1199554441 X:149091129-149091151 TATCTGCAAGGATTTTTACATGG - Intergenic