ID: 959551176

View in Genome Browser
Species Human (GRCh38)
Location 3:107659798-107659820
Sequence TTTCTAGTCTCACTAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 2, 3: 177, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959551176_959551180 24 Left 959551176 3:107659798-107659820 CCTGGGTTTAGTGAGACTAGAAA 0: 1
1: 0
2: 2
3: 177
4: 223
Right 959551180 3:107659845-107659867 CCTAGCAAGAGGTTTATGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 114
959551176_959551177 13 Left 959551176 3:107659798-107659820 CCTGGGTTTAGTGAGACTAGAAA 0: 1
1: 0
2: 2
3: 177
4: 223
Right 959551177 3:107659834-107659856 ATGCATCAGTTCCTAGCAAGAGG 0: 1
1: 0
2: 1
3: 7
4: 107
959551176_959551178 20 Left 959551176 3:107659798-107659820 CCTGGGTTTAGTGAGACTAGAAA 0: 1
1: 0
2: 2
3: 177
4: 223
Right 959551178 3:107659841-107659863 AGTTCCTAGCAAGAGGTTTATGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959551176 Original CRISPR TTTCTAGTCTCACTAAACCC AGG (reversed) Intronic
900907988 1:5574320-5574342 TCTCTAGTTTCAATAAACCAGGG - Intergenic
905751822 1:40472018-40472040 TCTCTAGTCTCAATAAACCAGGG + Intergenic
906601498 1:47133463-47133485 TCTCTAGTCTCAACAAACCAGGG + Intergenic
906929226 1:50152473-50152495 TTCCTAGTCTCAATCAACCAGGG - Intronic
907254582 1:53168956-53168978 TCTCTAGTCTCAATAAACCAGGG - Intergenic
907596159 1:55721821-55721843 TTCCTAGTATCACTACATCCTGG - Intergenic
908024764 1:59938873-59938895 TCTCTAGTCTCGATAAACCAGGG - Intergenic
908238783 1:62171694-62171716 TCTCTAGTCTCGATAAACCAGGG - Intergenic
909533061 1:76702364-76702386 TTTTTACTCTCACTATACACAGG - Intergenic
910851190 1:91651194-91651216 TTTCTGGTCTCACTCAGGCCAGG + Intergenic
911405446 1:97432355-97432377 TGTCTAGTCTCCCTTAAGCCTGG + Intronic
912625405 1:111201787-111201809 TTTCTAGTCCCACAGAAGCCAGG - Intronic
912814411 1:112817493-112817515 TCTCTAGTCTCAATAAACCAGGG - Intergenic
914338180 1:146736122-146736144 TTTCTTGTCGCAGTAAACTCAGG - Intergenic
914441346 1:147710123-147710145 TCTCTAGTCTCAATAAACCAGGG - Intergenic
914773103 1:150709474-150709496 TCTCTAGTCTCAATAAACCAGGG + Intronic
915052367 1:153088966-153088988 TCTCTAGTCTCAGTAAACCAGGG - Intergenic
916106173 1:161434188-161434210 TCTCTAGTCTCAATAAACCAGGG + Intergenic
919148401 1:193663914-193663936 TCTCTAATCTCACTAAGCCAAGG - Intergenic
920804872 1:209223534-209223556 TTCCTATTCTTACTAAACCCAGG - Intergenic
922484873 1:225966117-225966139 TCTCTAGTCTCAATAAACCAGGG + Intergenic
922961942 1:229654983-229655005 TTTCTAGTCTCCATTAAGCCTGG - Intronic
923440347 1:234012529-234012551 TCTCTAGTCTCGATAAACCAGGG - Intronic
923725836 1:236504786-236504808 TCTCTAGTCTCAATAAACCAGGG + Intergenic
924953677 1:248907616-248907638 TCTCTAGTCTCAATAAACAAGGG - Intronic
1063133759 10:3199277-3199299 TTTCTACTAAAACTAAACCCAGG - Intergenic
1064527979 10:16277874-16277896 TTTCTAGTGTCTCTGGACCCTGG - Intergenic
1065453420 10:25881819-25881841 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1065809319 10:29426999-29427021 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1066175044 10:32894744-32894766 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1070669230 10:78366453-78366475 TTTCTAGTTTCAGAAAACCATGG - Intergenic
1070998289 10:80806168-80806190 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1071865944 10:89731839-89731861 TTTCTAGTATCTCTAAACAAAGG - Intronic
1072410530 10:95197912-95197934 TCTCTAGTCTCAATAAACCAGGG - Intronic
1072541751 10:96403555-96403577 TCTCTAGTCTCAATAAACCAAGG + Intronic
1072708550 10:97700105-97700127 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1073106322 10:101034251-101034273 TCTCTAGTCTCAATAAACCAGGG - Intronic
1074411018 10:113228718-113228740 TTTCTCTTTTCACAAAACCCTGG - Intergenic
1074457079 10:113604547-113604569 TTTCTCCTTTCACCAAACCCGGG - Intronic
1076941189 10:133610266-133610288 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1077577454 11:3395271-3395293 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1077585453 11:3448142-3448164 TCTCTAGTCACAATAAACCAGGG - Intergenic
1077597358 11:3545639-3545661 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1079168573 11:18069957-18069979 TTTCAAGTCTAAGTAAACTCTGG + Intronic
1079664942 11:23093222-23093244 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1081019741 11:37930854-37930876 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1082267212 11:50131855-50131877 TCTCTAGTCTCAATAAACCAAGG - Intergenic
1082288876 11:50346713-50346735 TCTCTAGTCTCAATAAACCAAGG + Intergenic
1083797199 11:65023915-65023937 TCTCTAGTCTCAATAAACCAGGG - Intronic
1084226404 11:67717206-67717228 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1084229405 11:67740056-67740078 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1084242363 11:67830701-67830723 TCTCTAGTCACAATAAACCAGGG - Intergenic
1084253461 11:67921547-67921569 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1084259850 11:67968967-67968989 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1084808787 11:71599649-71599671 TCTCTAGTCTCAATAAACCAGGG + Intronic
1084812925 11:71626285-71626307 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1084819417 11:71674379-71674401 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1084845894 11:71899641-71899663 TCTCTATTCTCAATAAACCAGGG + Intronic
1085463883 11:76711374-76711396 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1086017805 11:82188094-82188116 TTTCTAGTCTTTCTAAAACTTGG + Intergenic
1086727502 11:90206245-90206267 CTTCTAGACTCTCTAGACCCTGG + Exonic
1087530069 11:99369388-99369410 TTTGTAGTCACTCTTAACCCTGG + Intronic
1088858362 11:113777325-113777347 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1089512497 11:119008821-119008843 TCTCTAGTCTCAATAAACCAGGG - Intronic
1090039706 11:123279969-123279991 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1092029207 12:5269832-5269854 TTTGTATTTTCAGTAAACCCGGG + Intergenic
1092405653 12:8220465-8220487 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1092412600 12:8265403-8265425 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1092431148 12:8409937-8409959 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1092434053 12:8432129-8432151 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1094815666 12:34180992-34181014 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1095080653 12:37995814-37995836 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1095456110 12:42387975-42387997 TCTCTAGTCTCGATAAACCAGGG + Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1096125418 12:49115932-49115954 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097132420 12:56822396-56822418 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1099305424 12:80948713-80948735 TTTCTTATATCACTAAATCCAGG - Intronic
1101798269 12:107997755-107997777 TCTCTAGTCTCAACAAACCAGGG - Intergenic
1102791561 12:115650493-115650515 ATCCTAGTCTAACTAAACACAGG - Intergenic
1103464274 12:121129249-121129271 TTGCGAGTCTCTCTAAACACTGG - Intergenic
1105055099 12:133091250-133091272 TCTCTAGTCTCAATAAACCAGGG - Intronic
1105055641 12:133096185-133096207 TCTCTAGTCTCAATAAACCAGGG - Intronic
1106814947 13:33397334-33397356 ACTCCAGTTTCACTAAACCCAGG + Intergenic
1107081504 13:36379655-36379677 TTTCTAGGCCCACTAAAACAAGG + Intergenic
1107667818 13:42711062-42711084 TCTCTAGTCTCAATAACCCAGGG + Intergenic
1108773815 13:53738187-53738209 CTTCTTGTCCCATTAAACCCAGG + Intergenic
1108900664 13:55403809-55403831 TTTATAGTCTCACTAAATATCGG - Intergenic
1113970191 13:114182628-114182650 CCTCTAGTCTCAATAAACCAGGG - Intergenic
1113991692 14:16032790-16032812 TCTCTAGTCTCAATAAACGAGGG + Intergenic
1114006529 14:18319736-18319758 TCTCTAGTCTCGATAAACCAGGG + Intergenic
1114072928 14:19129699-19129721 TCTCTAGTCTCGATAAACCAGGG + Intergenic
1114089337 14:19270294-19270316 TCTCTAGTCTCGATAAACCAGGG - Intergenic
1114168067 14:20242275-20242297 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1114607632 14:24010410-24010432 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1116509890 14:45731793-45731815 TTTCTACTCTTATTTAACCCAGG + Intergenic
1117335437 14:54753312-54753334 TCTCTAGTCTCAATAAACCAGGG - Intronic
1118355215 14:65008184-65008206 TTTCTAAACTCACTAAAGCCAGG - Intronic
1120503759 14:85328202-85328224 CTGCTAGTATCACTAAAGCCTGG + Intergenic
1121045633 14:90785606-90785628 TTTCCGGTCTCATTACACCCAGG - Intronic
1121527044 14:94626408-94626430 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1123136480 14:106031948-106031970 TGTCTACTCTCAATAAACCAGGG - Intergenic
1124495602 15:30185052-30185074 TTCCAAGTCTCACTAAAACATGG + Intergenic
1124747971 15:32353594-32353616 TTCCAAGTCTCACTAAAACATGG - Intergenic
1125562334 15:40644661-40644683 TCTCTAGTCTCAATAAACCAGGG - Intronic
1126002914 15:44228869-44228891 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1127255006 15:57282546-57282568 TTGGTAGTTTCACTAAGCCCAGG - Exonic
1131194838 15:90347280-90347302 TCTCTAGTCTCAATAAGCCATGG - Intergenic
1131946701 15:97629821-97629843 TCTCTAGTCTCAGTAAACCAGGG - Intergenic
1132831630 16:1931116-1931138 TCTCCAGTCTCAATAAACCAGGG + Intergenic
1134007872 16:10830175-10830197 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1134802734 16:17100313-17100335 TTTCTACTCTCACTTCACCCAGG + Intergenic
1135429437 16:22370761-22370783 TTTCTAACCTCAGTAAACTCTGG - Intronic
1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG + Intergenic
1136991451 16:35153722-35153744 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1137340578 16:47599346-47599368 TTTCTAGTTGTACTAAACCCAGG - Intronic
1139285943 16:65814141-65814163 TGTCAAGACTCACTAAATCCGGG + Intergenic
1139394368 16:66628446-66628468 TCTCTAGTCTCAATAAACCAGGG - Intronic
1139439168 16:66956097-66956119 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1139996100 16:70981219-70981241 TTTCTTGTCGCAGTAAACTCAGG + Intronic
1144571200 17:16400390-16400412 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1145363299 17:22229926-22229948 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1146101683 17:29988998-29989020 ATTCTAGTCTCACTAACCCTCGG - Intronic
1146993777 17:37299456-37299478 ATTCTAGTCTGACTGAAGCCAGG - Intronic
1149388005 17:56161097-56161119 TTCCTAGTCTCATTCAACCTCGG + Intronic
1151479930 17:74364063-74364085 TTTCTAATCTCCCTTATCCCTGG + Intergenic
1151725604 17:75882028-75882050 TTTGTGGCCTCACCAAACCCAGG - Intronic
1154111565 18:11572865-11572887 TTTCTACTGTCCCTAAACTCAGG + Intergenic
1154530941 18:15344462-15344484 TCTCTAGTCTCGATAAACCAAGG - Intergenic
1158235650 18:55310345-55310367 TATCTACTCTCATTAAACCTTGG + Intronic
1158623043 18:59048991-59049013 CTTCTAGTCTCACTCCCCCCAGG + Intergenic
1159532696 18:69675237-69675259 TTCTTCGTCTCATTAAACCCTGG + Intronic
1159606433 18:70479409-70479431 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1159948122 18:74458372-74458394 TTTCTATTATCTCTAAACTCGGG - Intergenic
1164055767 19:21620930-21620952 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1166172212 19:41036763-41036785 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1166248012 19:41544866-41544888 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1168235410 19:55059960-55059982 TCTCTAGTCTCAATAAACCAGGG + Intronic
1168608521 19:57779240-57779262 CATCTAGTCTCATTAAACACAGG + Exonic
1168611953 19:57808151-57808173 GCTCCAGTCTCACTAAACACAGG - Exonic
1168616589 19:57842443-57842465 TCTCCAGTCTCACTAATCACAGG + Intronic
1168618780 19:57860007-57860029 GTTCCAGTCTCATTAAACACAGG + Exonic
1168624730 19:57908661-57908683 GTTCCAGTCTCATTAAACACAGG - Exonic
924967828 2:94320-94342 TCTCTAGTCTCAATAAACCAGGG + Intergenic
925037676 2:703268-703290 TCTCTAGTCTCAATAAGCCAGGG - Intergenic
927188841 2:20501888-20501910 TCTCTAGTCTCAATAAACCAGGG - Intergenic
930196955 2:48519821-48519843 TTCCTTGTCTCACTAAAAACAGG - Intergenic
932600352 2:73119897-73119919 TCTCTAGTCTCGATAAACCACGG - Intronic
932798665 2:74720237-74720259 TCTCTAGTCTCAATAAACCAGGG + Intergenic
934542954 2:95191628-95191650 TCTCTAGTCTCAATAAACCAGGG + Intergenic
934592370 2:95567453-95567475 TCTCTAGTCTCAATAAACCAGGG + Intergenic
935025637 2:99274178-99274200 ATTCTAGTCTCACTAGCCCTTGG - Intronic
935656140 2:105425315-105425337 TCTCTAGTCTCAATAAACCAGGG + Intronic
935821721 2:106899814-106899836 TTTCTAGTGTCCCTAAGCTCAGG - Intergenic
935919290 2:107993492-107993514 TTAGTATTCTCACTAACCCCTGG - Intronic
936107510 2:109637555-109637577 TCTCTAGTCTCAATAAACCAGGG - Intergenic
938235350 2:129701638-129701660 TCTCTAGTCTCAATAAACCAGGG + Intergenic
938530031 2:132175736-132175758 TCTCTAGTCTCGATAAACCAGGG - Intronic
939027915 2:137035655-137035677 TTTGTAGTAGCTCTAAACCCAGG + Intronic
940358358 2:152769796-152769818 TCTCTAGTCTCGATAAACCAGGG - Intergenic
942577633 2:177381397-177381419 TCTCTAGTCTAACTGAACCATGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944996016 2:205294731-205294753 TTTTAAGTCTCACAAATCCCAGG - Intronic
945437975 2:209841281-209841303 TTTCTAATCTCACTAAAACCAGG + Intronic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
948843437 2:240671633-240671655 TCTCCAGTCTCAATAAACCAGGG + Intergenic
1170397883 20:15947383-15947405 TCTCCAGTCTCAATAAACCAGGG - Intronic
1171272889 20:23830039-23830061 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1171350633 20:24499994-24500016 TTTCACTTCTCACTAAATCCGGG - Intronic
1171770173 20:29316872-29316894 TCTCTAGTCTCAATAAACGAGGG - Intergenic
1171812882 20:29759667-29759689 TCTCTAGTCTCAATAAACGAGGG - Intergenic
1172835438 20:37870224-37870246 TTCCTGGTCTCACTGAAACCTGG + Intronic
1174216388 20:48919899-48919921 TTTGTTGTCTCACTAAAGCACGG - Intergenic
1175726262 20:61320720-61320742 CTTCAGGTCTCACTAAAGCCAGG - Intronic
1176766470 21:13024000-13024022 TCTCTAGTCTCGATAAACCAAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178667293 21:34559711-34559733 TTTCAAGTTTCTCTAAAACCTGG + Intronic
1179123736 21:38573142-38573164 TCTCTAGCCTCAATAAACCAGGG + Intronic
1179937728 21:44615833-44615855 GTTCTCGTCTCATTTAACCCAGG + Intronic
1180315578 22:11274737-11274759 TCTCTAGTCTCAATAAACGAGGG - Intergenic
1180431038 22:15250547-15250569 TCTCTAGTCTCGATAAACCAGGG + Intergenic
1180491370 22:15852053-15852075 TCTCTAGTCTCGATAAACCAGGG + Intergenic
1180513601 22:16118448-16118470 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1181341565 22:22184306-22184328 TTTCTAGTTTCCCTAGATCCAGG - Intergenic
949804659 3:7941962-7941984 TCTCTAGTCTCAATAAACCATGG + Intergenic
950332750 3:12169513-12169535 TTTTTGGTCTCACTGAGCCCTGG + Intronic
950753076 3:15146240-15146262 TCTCTAGTCTCAATAAACCAGGG - Intergenic
950857082 3:16115816-16115838 TTTCTTGTCCCACTGAACCTGGG + Intergenic
951701008 3:25496781-25496803 TTCCTTTTCTCAGTAAACCCAGG - Intronic
952053376 3:29413634-29413656 TTTCTAATCTTACTTAACCCTGG - Intronic
952685388 3:36141790-36141812 TCTCTAGTCTCAATAAACCAGGG - Intergenic
953757318 3:45657926-45657948 TTTCTACGCTCACTGAAACCTGG + Intronic
954267610 3:49482164-49482186 TCTCTAGTCTCAATAAACTGGGG + Intronic
954541342 3:51394892-51394914 TTTCTAGCCTCACTCAGCCCAGG + Exonic
955257088 3:57343472-57343494 TCTCTAGTCTCAGCAAACCAGGG + Intronic
957045983 3:75374883-75374905 TCTCCAGTCTCAATAAACCAGGG - Intergenic
957067528 3:75538008-75538030 TCTCTAGTCTCAATAAACCAGGG + Intergenic
957069870 3:75559257-75559279 TCTCTAGTCTCAATAAACCAGGG + Intergenic
957074801 3:75593390-75593412 TCTCTAGTCTCAATAAACCAGGG - Intergenic
957725216 3:84055774-84055796 TTTCTCTTCTCCCTAACCCCTGG + Intergenic
958765597 3:98363275-98363297 TCTCTAGTCTCAATAAACCAGGG - Intergenic
959551176 3:107659798-107659820 TTTCTAGTCTCACTAAACCCAGG - Intronic
960308095 3:116087219-116087241 TTTCTAGTCACACTAAATGCAGG + Intronic
961276403 3:125730727-125730749 TCTCTAGTCTCAATAAACCAGGG + Intergenic
961285621 3:125799965-125799987 TCTCTAGTCTCAATAAACCAGGG - Intergenic
961875095 3:130016291-130016313 TGTCTAGTCTCAATAAACCAGGG - Intergenic
961878034 3:130039006-130039028 TCTCTAGTCTCAATAAACCAGGG - Intergenic
961890163 3:130124055-130124077 TCTCTAGTCTCAATAAACCGAGG - Intergenic
963216341 3:142752764-142752786 TCTCTAGTCTCAATAAACCAGGG - Intronic
964397122 3:156257259-156257281 ATTCTTGTCTCACTAAAGTCTGG - Intronic
966682713 3:182660332-182660354 TTTCTGGTCTCCCTCAACTCAGG - Intergenic
966733546 3:183170266-183170288 TCTCTAGTCTCAATAAACCAGGG + Intergenic
966771932 3:183511641-183511663 TCTCCAGTCTCAATAAACCAGGG - Intronic
966994399 3:185265726-185265748 TTTGTAGCCTCAATAAGCCCCGG - Intronic
968061417 3:195728817-195728839 TCTCTAGTCTCAATAAACCAGGG - Intronic
968373696 4:19290-19312 TCTCTAGTCTCAATAAACCAGGG + Intergenic
968397127 4:250670-250692 TTTCTACTCTCACTCCACCTTGG + Intergenic
968987448 4:3884068-3884090 TCTCTAGTGTCAATAAACCAGGG - Intergenic
968990249 4:3906039-3906061 TCTCTAGTCTCAATAACCCAGGG - Intergenic
969000636 4:3978043-3978065 TCTCTAGTCTCAACAAACCAAGG - Intergenic
969001558 4:3986620-3986642 TCTCTAGTCTCAACAAACCAGGG - Intergenic
969012108 4:4074578-4074600 TCTCTTGTCTCAATAAACCAGGG + Intergenic
969018404 4:4121028-4121050 TCTCTAGTCTCAATAAACCAGGG - Intergenic
969023092 4:4151229-4151251 TTTCTAGTCTCAATAAACCAGGG - Intergenic
969730715 4:8955854-8955876 TCTCTAGTCTCAATAAACCAGGG + Intergenic
969735581 4:8987690-8987712 TCTCTAGTCTCAATAAACCAGGG + Intergenic
969741980 4:9035131-9035153 TCTCTTGTCTCAATAAACCAGGG - Intergenic
969752460 4:9122071-9122093 TCTCTAGTCTCAATAAACCAGGG + Intergenic
969753380 4:9130630-9130652 TCTCTAGTCACAATAAACCAGGG + Intergenic
969760462 4:9177518-9177540 TCTCTAGTCTCAATAAACCAGGG - Intergenic
969786886 4:9465483-9465505 TCTCTAGTCTCAATAAACCAGGG + Intergenic
969790314 4:9489962-9489984 TCTCTAGTCTCAATAAACCAGGG + Intergenic
969794799 4:9519145-9519167 TCTCTAGTCTCAATAAACCAGGG + Intergenic
969801352 4:9568031-9568053 TCTCTAGTCTCAATAAACCAGGG - Intergenic
969812359 4:9658240-9658262 TCTCTAGTCTCAACAAACCAGGG + Intergenic
969813282 4:9666813-9666835 TCTCTAGTCTCAACAAACCAAGG + Intergenic
969825074 4:9751327-9751349 TCTCTAGTCTCAATAAACCAGGG + Intergenic
970418063 4:15878815-15878837 TCTCTAGTCTCAATAAACCAGGG + Intergenic
970808820 4:20067041-20067063 TTTCTAGGGTCAATAAATCCTGG + Intergenic
970941559 4:21640483-21640505 ATTCCAGTCTCCCTAAACCTTGG + Intronic
971659739 4:29398003-29398025 ATTCTAGTGTGACTAAACACAGG + Intergenic
971720088 4:30233603-30233625 TCTCTAGTCTCAATAAACCAGGG - Intergenic
972510880 4:39768131-39768153 TTTCTAGTCTCACAATAACAAGG - Intronic
972846956 4:43002351-43002373 TCTCTAGTCTCAATAAACCAGGG - Intronic
974945872 4:68528527-68528549 TCTCTAGTCTCAATAAACCAGGG + Intergenic
974952342 4:68598287-68598309 TCTCTAGTCTCAATAAACCAGGG + Intronic
975168419 4:71204752-71204774 TTTCTAGTCTAACTTAACCTTGG + Intronic
975658290 4:76663307-76663329 TTTGAAATCTCACTCAACCCGGG + Intronic
975755009 4:77563096-77563118 TTTCTAGTCTCACTGGCCTCAGG - Intronic
977457247 4:97277074-97277096 TTTCTAGTCTAAATAAACACAGG - Intronic
978048899 4:104171255-104171277 TCTCTAGTCTCAATAAACCAGGG + Intergenic
979497181 4:121396813-121396835 TCTCTAGTCTCAATAAACCAGGG + Intergenic
979501627 4:121446737-121446759 TCTCTAGTCTCAATAAACCAGGG - Intergenic
979996739 4:127440190-127440212 TCTCTAGTCTCAATAAACCAGGG - Intergenic
980107023 4:128597979-128598001 TTTCATGTCTCCCTGAACCCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982057419 4:151566388-151566410 TTGCTGGTCTCAGTAACCCCAGG + Intronic
982518815 4:156387072-156387094 TCTCTAGTCTCAATAAACCAGGG - Intergenic
983212734 4:164975644-164975666 TCTCTAGTCTCAATAAACCAGGG + Intronic
983313292 4:166093782-166093804 TCTCTAGTCTCGATAAACCAGGG - Intronic
984227634 4:177054199-177054221 ATTCTACTCTAACTCAACCCTGG + Intergenic
984786592 4:183572958-183572980 TTTTTAACCTCGCTAAACCCAGG - Intergenic
984802391 4:183726978-183727000 TCTCTAGTCTCAATAAACCAGGG - Intergenic
985461041 4:190106977-190106999 TCTCTAGTCTCAATAAACCAGGG - Intergenic
985461691 4:190113261-190113283 TCTCTAGTCTCAATAAACCAGGG - Intergenic
986110019 5:4705986-4706008 TTTCTAGTCTTACCAAACAGTGG - Intergenic
987026773 5:13934904-13934926 TTTCAAATGTCACTAAAGCCAGG + Intronic
987334254 5:16885035-16885057 TTTCTGGTATCATTAAAACCGGG + Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987807954 5:22794608-22794630 TTTCTATTCTCTCTAAATCTTGG - Intronic
988062972 5:26197692-26197714 TCTCTAGTCTCAATAAACCAGGG + Intergenic
989227145 5:39042068-39042090 TTTCTAGGCACACTTGACCCTGG - Intronic
989296147 5:39828760-39828782 TCTCTAGTCTCAATAAACCAGGG - Intergenic
990447030 5:55903127-55903149 TCTCGGGTCTCACAAAACCCAGG - Intronic
990619726 5:57546926-57546948 TCTCTAGTCTCAATAAACCAGGG + Intergenic
993297598 5:86162086-86162108 TTAATAGTTTCACTAAAACCTGG - Intergenic
994404571 5:99328681-99328703 TCTCTAGTCTCAATAAACCAGGG + Intergenic
994503186 5:100606311-100606333 TCTCTAGTCTCAGTAAACCAGGG + Intergenic
998753013 5:145345226-145345248 ATTCCATTCTCACTAAGCCCTGG + Intergenic
999752209 5:154636673-154636695 TCTCTAGTCTCAATAAACCAGGG - Intergenic
999753058 5:154644367-154644389 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1000526994 5:162370390-162370412 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1002268933 5:178056737-178056759 TCTCCAGTCTCAATAAACCAGGG - Intergenic
1003665980 6:8111729-8111751 TTTCTATTCTCGCTAGTCCCTGG + Intergenic
1004478902 6:16000304-16000326 TTTTTATGCTCACTTAACCCAGG - Intergenic
1004882845 6:20025757-20025779 TTTCCAGGCTCACAAAGCCCTGG + Intergenic
1005430278 6:25749202-25749224 TCTCTATTCTCAATAAACCAGGG - Intergenic
1005618427 6:27597441-27597463 TCTCTAGTCTCGATAAACCAGGG - Intergenic
1007624930 6:43240214-43240236 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1008563925 6:52748995-52749017 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1008585888 6:52948417-52948439 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1008647921 6:53534106-53534128 TTTCTAAGCTCACACAACCCGGG + Intronic
1009193286 6:60655271-60655293 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1009193700 6:60660242-60660264 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1010423882 6:75704797-75704819 TCTCTAGTCTCGATAAACCAGGG - Intronic
1010839711 6:80634941-80634963 TCTCTAGTCTGAATAAACCAGGG + Intergenic
1012120621 6:95361919-95361941 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1014015856 6:116529207-116529229 TTGCAAATCTCACTAGACCCTGG + Intronic
1016177349 6:141096928-141096950 TCTCTAGTCTTAATAAACCAGGG - Intergenic
1016553855 6:145313128-145313150 TTTCTGGGCTCTCTAATCCCTGG + Intergenic
1017372899 6:153734712-153734734 TTACTACTCTCACAAAACACTGG + Intergenic
1018060131 6:160083631-160083653 TCTCTAGTCTCAATAAACCAGGG - Intronic
1020310143 7:6860953-6860975 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1020313082 7:6884093-6884115 TCTTTAGTCTCAATAAACCAGGG - Intergenic
1020503891 7:8959032-8959054 CTGCTAGTTTCACTAAACCGAGG - Intergenic
1020503995 7:8960351-8960373 CTGCTAGTTTCACTAAGCCCAGG - Intergenic
1020822278 7:12985200-12985222 TTCCAAGTCTCACACAACCCAGG - Intergenic
1020948112 7:14641099-14641121 TTGCTATTCTCATTAAACACTGG - Intronic
1022110454 7:27226977-27226999 TTTCCAGTCTCCCTTTACCCTGG - Intergenic
1023248371 7:38231561-38231583 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1025075990 7:55943595-55943617 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1026188681 7:68104470-68104492 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1026555639 7:71406462-71406484 TTTCAGGTCCCACAAAACCCAGG + Intronic
1028173954 7:87631329-87631351 TTTCCAGAGTCACCAAACCCTGG + Intronic
1028467110 7:91164864-91164886 TTTCTAGTCCCAGTATCCCCTGG + Intronic
1029076891 7:97941736-97941758 TCTCTATTCTCAATAAACCAGGG - Intergenic
1030009142 7:105148924-105148946 TCTCTAGTCTCAATAAACCAGGG + Intronic
1033715440 7:143996833-143996855 TCTCTAGTCTCGATAAACCAGGG - Intergenic
1035156234 7:156915562-156915584 TTTCAAGTCTAAATAAGCCCAGG - Intergenic
1035518001 8:253042-253064 GCTCTAGTCTCAATAAACCAGGG + Intergenic
1036240886 8:7080218-7080240 TCTCTCGTCTCATTAAACCAGGG + Intergenic
1036247172 8:7127698-7127720 TCTCTAGTCTGAATAAACCAGGG - Intergenic
1036253624 8:7186664-7186686 TCTCTCGTCTCAATAAACCAGGG + Intergenic
1036261170 8:7241373-7241395 TCTCTAGTATCAATAAACCAGGG - Intergenic
1036262795 8:7253628-7253650 TCTCTAGTTTCAATAAACCAGGG - Intergenic
1036264103 8:7261260-7261282 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036265398 8:7268882-7268904 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036266700 8:7276504-7276526 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036268006 8:7284126-7284148 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036269310 8:7291748-7291770 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036270575 8:7299358-7299380 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036297285 8:7547676-7547698 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1036298586 8:7555331-7555353 TCCCTAGTCTCAATAAACCAGGG + Intergenic
1036299891 8:7562981-7563003 TCCCTAGTCTCAATAAACCAGGG + Intergenic
1036301198 8:7570627-7570649 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1036302498 8:7578276-7578298 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1036303794 8:7585930-7585952 TCTCTAGTTTCAATAAACCAGGG + Intergenic
1036305433 8:7598174-7598196 TCTCTAGTATCAATAAACCAGGG + Intergenic
1036313209 8:7699917-7699939 TCTCTAGTATCAATAAACCAGGG - Intergenic
1036314835 8:7712167-7712189 TCTCTAGTTTCAATAAACCAGGG - Intergenic
1036316143 8:7719799-7719821 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036317452 8:7727447-7727469 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036318760 8:7735095-7735117 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036320067 8:7742742-7742764 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036321376 8:7750390-7750412 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036322685 8:7758038-7758060 TCCCTAGTCTCAATAAACCAGGG - Intergenic
1036323988 8:7765687-7765709 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036350774 8:8010986-8011008 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1036352052 8:8018620-8018642 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1036353351 8:8026266-8026288 TCTCCAGTCTCAATAAACCACGG + Intergenic
1036354649 8:8033922-8033944 TCTCTAGTTTCAATAAACCAGGG + Intergenic
1036356283 8:8046171-8046193 TCTCTAGTATCAATAAACCAGGG + Intergenic
1036363868 8:8100816-8100838 TCTCTCGTCTCAATAAACCAGGG - Intergenic
1036375672 8:8197466-8197488 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1036376589 8:8205961-8205983 TCTCTAGTCACAATAAACCACGG + Intergenic
1036846049 8:12171414-12171436 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1036852949 8:12217177-12217199 TCTCTAGTCACAATAAACCACGG - Intergenic
1036853858 8:12225678-12225700 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1036867414 8:12413733-12413755 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1036874322 8:12459699-12459721 TCTCTAGTCACAATAAACCACGG - Intergenic
1036875229 8:12468188-12468210 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1036894680 8:12624364-12624386 TCTCTCGTCTCAATAAACCAGGG + Intergenic
1036902270 8:12679123-12679145 TCTGTAGTCTCAATAAACCAGGG - Intergenic
1039674614 8:39647703-39647725 TCTCTAGACTCAATAAACCAGGG - Intronic
1040339195 8:46431695-46431717 TCTCTAGTCTCAATAAGCCAGGG - Intergenic
1040340962 8:46440635-46440657 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1040822001 8:51570929-51570951 TTTCTATTCTCACTATACTTGGG + Intronic
1042204412 8:66313771-66313793 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1043136658 8:76535659-76535681 TTTCTAGTGCCATTATACCCTGG - Intergenic
1048429667 8:134358355-134358377 TTTCTAGACTAACTGAAGCCTGG - Intergenic
1049506241 8:143001041-143001063 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1049725876 8:144145989-144146011 TCTCTAGTCTCGATAAACCAGGG + Intergenic
1049867702 8:144949714-144949736 TCTCCAGTCTCAATAAACCAGGG + Intronic
1050065696 9:1757452-1757474 TTTCTACTCTCTCTAAACACAGG + Intergenic
1050385260 9:5082724-5082746 TCTCCAGTCTCAATAAACCAGGG - Intronic
1052469843 9:28880479-28880501 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1053131488 9:35618115-35618137 TTTCTCTTCTCTCTAGACCCAGG - Exonic
1053708641 9:40782209-40782231 TCTCTAGTCTCGATAAACCAAGG - Intergenic
1053736365 9:41105449-41105471 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1054418551 9:64903004-64903026 TCTCTAGTCTCGATAAACCAAGG - Intergenic
1054692008 9:68325951-68325973 TCTCTAGTCTCAATAAACCAGGG - Intergenic
1055540912 9:77304142-77304164 TCTCTAGTCTCAATAAACCTGGG - Intronic
1055787877 9:79890165-79890187 TTTTTAGTCTCACAAATCTCTGG - Intergenic
1058133010 9:101274773-101274795 TCTCTAGTCTTATTAAACCTGGG - Intronic
1060027814 9:120187708-120187730 TTTCTTTTCTCAAGAAACCCCGG - Intergenic
1060831029 9:126716786-126716808 TCTCTAGTCTCAGTAAACCGGGG + Intergenic
1061154641 9:128850504-128850526 TCTCTAGTCTCAATAAACCAGGG + Intronic
1061155260 9:128856720-128856742 TCTCTAATCTCAATAAACCAGGG + Intronic
1203363863 Un_KI270442v1:240659-240681 TCTCTAGTCTCAATAAACGAGGG - Intergenic
1185444764 X:251847-251869 CCTCTAGTCTCAATAAACCAGGG - Intergenic
1186081292 X:5936271-5936293 TTTCTAATCCTACGAAACCCAGG + Intronic
1187325998 X:18289050-18289072 TTTCTAGTTTCTCTGACCCCGGG - Intronic
1191781595 X:64874040-64874062 TTACTAGTTTCACTCAACACAGG - Intergenic
1194219195 X:91170554-91170576 TCTCTAGTCTTAATAAACCAGGG + Intergenic
1194499445 X:94661766-94661788 TTTCTGGTTTCAGAAAACCCAGG + Intergenic
1196133989 X:112187332-112187354 TTTCATGTCTCACAAATCCCAGG - Intergenic
1197509520 X:127354209-127354231 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1200245405 X:154521444-154521466 TCTCTAGTCTCAATAAACCAGGG + Intergenic
1200555713 Y:4634311-4634333 TCTCTAGTCTTAATAAACCAGGG + Intergenic
1200752478 Y:6959117-6959139 TCTCTAGTCTCAATAAACCAGGG - Intronic
1201452680 Y:14133464-14133486 TCTCTAGTCTCAATAAACCAGGG + Intergenic