ID: 959551941

View in Genome Browser
Species Human (GRCh38)
Location 3:107669848-107669870
Sequence AGTGGTCAAAATTCATAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959551936_959551941 20 Left 959551936 3:107669805-107669827 CCTAGTCTACTTTTACAGATTAA 0: 1
1: 0
2: 0
3: 18
4: 271
Right 959551941 3:107669848-107669870 AGTGGTCAAAATTCATAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 134
959551935_959551941 21 Left 959551935 3:107669804-107669826 CCCTAGTCTACTTTTACAGATTA 0: 1
1: 0
2: 0
3: 20
4: 226
Right 959551941 3:107669848-107669870 AGTGGTCAAAATTCATAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959551941 Original CRISPR AGTGGTCAAAATTCATAGCC AGG Intronic
902189597 1:14752907-14752929 AGTGGTCCAAATGCACAGCTGGG - Intronic
902627067 1:17682963-17682985 AGAGCTCAGAATTCATTGCCAGG - Intronic
911845662 1:102747923-102747945 AGTGGACATAACTGATAGCCCGG + Intergenic
915745058 1:158149648-158149670 ACTGTTCCAAATGCATAGCCTGG + Intergenic
916877336 1:168983452-168983474 AGAGGTAGAAATTCAGAGCCAGG - Intergenic
918433747 1:184489273-184489295 AATGGACAAAGTTCATGGCCAGG + Intronic
918916220 1:190642194-190642216 AGTGTTTACACTTCATAGCCAGG + Intergenic
919282885 1:195514683-195514705 TGTTGGCAAAATTCACAGCCTGG + Intergenic
921404406 1:214763662-214763684 AGTGGCCAACATTCATATTCAGG - Intergenic
922850297 1:228727609-228727631 AGTTGTCAAAATTCATTGCTGGG - Intergenic
1063192644 10:3711718-3711740 AAAGGTCAAAATTCATATCTAGG + Intergenic
1064312196 10:14221361-14221383 TGTGGCCTAATTTCATAGCCTGG + Intronic
1064734989 10:18372903-18372925 AGTGGACAAAAGTCATACCAAGG - Intronic
1067244587 10:44527570-44527592 AGGGGTAAAACTTCATAACCAGG - Intergenic
1069970713 10:72166070-72166092 TGAGGTCAAAATTCAAACCCAGG + Intronic
1070170930 10:73932276-73932298 AGGGGTGAAAATTAAGAGCCAGG - Intergenic
1070347056 10:75554710-75554732 AGTGACCAAAATTCAAAACCTGG + Intronic
1071285040 10:84136748-84136770 AGTGGAGAAAACTCAGAGCCAGG - Intergenic
1072246952 10:93552406-93552428 AGCTGTCCAAATTCAAAGCCAGG - Intergenic
1073466152 10:103695629-103695651 AGTGGTTAAAATTCAGATGCAGG + Intronic
1073989475 10:109246029-109246051 AGTGGTCAGTATTCTTAGCATGG + Intergenic
1074225741 10:111482470-111482492 TGTGGCTAAAATTCATGGCCTGG - Intergenic
1079869800 11:25782679-25782701 AGAGGACAAAATTCAAATCCAGG + Intergenic
1081925655 11:46826307-46826329 AGTTGTCCTAATTCACAGCCAGG - Intronic
1082181004 11:49119571-49119593 AGTAGTCAATATACAAAGCCTGG + Intergenic
1082690923 11:56303617-56303639 AGTGGTCAAAAGACATGACCAGG - Intergenic
1084947406 11:72645922-72645944 AGTAGTCAAAATTCAAACCCAGG + Intronic
1086156022 11:83666812-83666834 AGGGGGCAAAATTCAAAGCCTGG + Intronic
1088876772 11:113942906-113942928 ATTTGGCCAAATTCATAGCCAGG - Intronic
1090904085 11:131058645-131058667 AATGGTCAAACTTCACAGCATGG + Intergenic
1090962847 11:131572502-131572524 AAAGGTCAAAAGGCATAGCCAGG - Intronic
1091193064 11:133710353-133710375 AGTGGTCTAAAATCTGAGCCTGG - Intergenic
1095309510 12:40681230-40681252 AGAGTTCAAAAATCATAACCAGG + Intergenic
1096124480 12:49109661-49109683 AGAGGTGAAAATTCAAAGCAAGG + Intronic
1097170112 12:57107982-57108004 ATCTGTCAACATTCATAGCCTGG + Intronic
1098614593 12:72507635-72507657 AGTTTGGAAAATTCATAGCCTGG + Intronic
1101396143 12:104349811-104349833 AGTGGTCAAAATACATTTCTGGG + Exonic
1101546742 12:105720566-105720588 AGTGGTCAACATCCTTAGACTGG - Intergenic
1104925493 12:132311930-132311952 AATCATCAAAATTAATAGCCAGG - Intronic
1110458765 13:75720010-75720032 AATGGTCAAAATTCAGAACACGG - Intronic
1111837407 13:93405478-93405500 AGTGGTAAAAAGTCATTTCCAGG + Intronic
1112363466 13:98738218-98738240 AGTTGGGAAAATTTATAGCCTGG + Intronic
1115121580 14:29943042-29943064 AGTGGTCCAAGATCATAGACTGG - Intronic
1124633831 15:31352687-31352709 AGTGGTCATAATTCAGAGCTGGG - Intronic
1125920222 15:43521020-43521042 AGTGGGCAAAGTTTAGAGCCTGG + Exonic
1128144707 15:65326476-65326498 GGTGGTCAGAATGCAGAGCCTGG + Intergenic
1129742973 15:77999044-77999066 AGTGCTACAAATCCATAGCCAGG - Intronic
1129842506 15:78752403-78752425 AGTGCTACAAATCCATAGCCAGG + Intergenic
1130898169 15:88186859-88186881 GATGGTCAAAATGCATATCCTGG + Intronic
1131928130 15:97408745-97408767 AGTGGTCAGGATTCAAATCCAGG + Intergenic
1134912752 16:18042764-18042786 GGTGGCCAGAATTCATGGCCTGG + Intergenic
1140906731 16:79415568-79415590 TGTGGTCAGCATTCAAAGCCTGG + Intergenic
1141518819 16:84564071-84564093 AGTGATCCTAATTCACAGCCAGG + Intergenic
1144080678 17:11761345-11761367 ATGGGTCAGAAGTCATAGCCAGG - Intronic
1146171773 17:30640062-30640084 ACTGGACCAAATTCATGGCCAGG - Intergenic
1146345228 17:32056087-32056109 ACTGGACCAAATTCATGGCCAGG - Intergenic
1148531439 17:48397101-48397123 AGTTTTCTAAATTCATAGCAAGG - Intronic
1150042663 17:61880455-61880477 AATGGTAAAAATTCCTGGCCAGG + Intronic
1150675070 17:67238048-67238070 AGTACTGAAAATTCATGGCCAGG + Intronic
1150933156 17:69607017-69607039 AGTGGTTAAAATTCAGAAGCTGG + Intergenic
1153637881 18:7128687-7128709 ATTGGTCAAAATTCATCCCATGG - Intergenic
1157014581 18:43696069-43696091 AGAGGTCAAAATTCATAAGAAGG - Intergenic
1157374225 18:47148893-47148915 AGTTGTATAAATTTATAGCCTGG + Intronic
1157534669 18:48449507-48449529 AGTGGACAAAGTGCACAGCCTGG - Intergenic
1157578906 18:48761990-48762012 AGAGGTCAAAGCACATAGCCAGG - Intronic
1158454075 18:57591388-57591410 AGTTGTATAAATTCACAGCCAGG + Intergenic
1160321046 18:77896133-77896155 AGTATTTAAAATGCATAGCCGGG + Intergenic
1164819725 19:31238549-31238571 GGGCATCAAAATTCATAGCCGGG - Intergenic
1167794382 19:51699956-51699978 AGTGGTCAAAACACAAGGCCAGG + Intergenic
925464775 2:4097114-4097136 AGTGGTGATAATTCTTAGCAAGG + Intergenic
925833740 2:7922574-7922596 ATTCCTCAAAATTCAAAGCCAGG + Intergenic
927964593 2:27261481-27261503 AGTGGGCAACATTCATTCCCTGG + Intronic
928535501 2:32236176-32236198 GGTAGTCGAAATACATAGCCTGG - Intronic
934012321 2:87836093-87836115 AGAGGTCAACATTCATATCCAGG + Intergenic
935389699 2:102537531-102537553 AGCGGTCTGATTTCATAGCCTGG - Intergenic
935812441 2:106811977-106811999 AGTGGTCACAACTCATTGCTGGG - Intronic
940105139 2:150091042-150091064 AGTGGTCAAAATTAAAAGCTTGG - Intergenic
945693484 2:213072022-213072044 ATTGGTCAAAAATAATAGCTTGG + Intronic
945824935 2:214710193-214710215 AGGGGTAAAAATACATAGCAAGG + Intergenic
945877275 2:215291580-215291602 ACTGGTCAAAAGCCATTGCCAGG + Intergenic
1170563919 20:17583203-17583225 GGTGCTCCAACTTCATAGCCTGG - Intronic
1173940233 20:46904722-46904744 AGTGGGCACCATTCAAAGCCAGG - Intronic
1175555999 20:59857433-59857455 AGTTTTGAAAATTCACAGCCTGG + Intergenic
1177320612 21:19514839-19514861 AGAGGCCAAAATTCAAATCCAGG + Intergenic
1177888937 21:26781535-26781557 TGTGGTTACAATTCATTGCCAGG - Intergenic
1179908664 21:44436753-44436775 AGTGGTCAAACTGCAAAGCTGGG + Intronic
953332293 3:42063857-42063879 ATTGGTCAAAATACATCACCGGG - Intronic
959551941 3:107669848-107669870 AGTGGTCAAAATTCATAGCCAGG + Intronic
963696702 3:148572995-148573017 AGGGGACATAATTGATAGCCCGG - Intergenic
964342042 3:155717916-155717938 AGTGTGGAAAATTCACAGCCTGG - Intronic
964757469 3:160101528-160101550 AGGGATGAAAATTCTTAGCCAGG + Intergenic
967113717 3:186318174-186318196 TGTGGGCAAAATTTAGAGCCAGG - Intronic
970189908 4:13505306-13505328 AGTGGTTTAAAGTCATAGCTGGG + Intergenic
970318127 4:14848622-14848644 AGTATTCAGTATTCATAGCCGGG + Intergenic
974068822 4:57105665-57105687 AGTGGTCAAGATTCACACCAAGG + Intronic
974782381 4:66570005-66570027 AATGGGCAAAAAACATAGCCAGG + Intergenic
976510879 4:85908743-85908765 TTTGGTCAAAATACAGAGCCAGG + Intronic
976534172 4:86192297-86192319 AGAGGCCAACATTCATATCCAGG - Intronic
977309733 4:95370963-95370985 AGTGATCACAATACATAGCAGGG + Intronic
977836556 4:101652096-101652118 AGTAGTCATAATACACAGCCAGG + Intronic
982317881 4:154049494-154049516 AGTGGCAAAATTTCATAGCTTGG + Intergenic
982582776 4:157200332-157200354 AGTGATCAAAATTCATTGAAAGG - Intergenic
982641055 4:157961623-157961645 AGTTGTCAAAAATCATAGCAGGG + Intergenic
988116841 5:26904709-26904731 GGTGGTCAGAATTCAAACCCAGG - Intronic
988357752 5:30199793-30199815 AGGGGACAAAACTGATAGCCTGG - Intergenic
992143378 5:73821073-73821095 ATTTGTCAACATTCATAACCAGG - Intronic
994275618 5:97833208-97833230 AGTGTTCAAAATACATAACGAGG - Intergenic
998091494 5:139373473-139373495 AGTTGTAAAAATTACTAGCCCGG - Intronic
999461974 5:151765231-151765253 ATAGGTCAAAATTCTTAGGCAGG + Intronic
1004495002 6:16155077-16155099 AGTGGTGGAAATTCAAAGCTGGG - Intergenic
1004729997 6:18348242-18348264 AGTAGACAGAATTGATAGCCTGG - Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1007089457 6:39173072-39173094 AGTTGTCAAAATTGAGAACCTGG + Intergenic
1015572530 6:134636250-134636272 AATGGTCAAAATGCAAAACCAGG + Intergenic
1021418534 7:20418268-20418290 AAAGCTCAAAATTCTTAGCCTGG - Intergenic
1027448732 7:78304702-78304724 TGTGGTGAAAAATCAAAGCCAGG + Intronic
1028698922 7:93753125-93753147 AGTGGTCCAAATCTGTAGCCAGG - Intronic
1029134220 7:98357271-98357293 AGAGTTAAAAATTTATAGCCAGG + Intronic
1031079913 7:117248389-117248411 AGTGGTCAGTCTTCATTGCCAGG - Intergenic
1032068142 7:128788166-128788188 AGTAGTTAAAATTCATAAACTGG + Intergenic
1036193673 8:6694986-6695008 AGTTGTCAAATTTTGTAGCCTGG + Intergenic
1037706867 8:21322658-21322680 AGTGGTGAATATTCATAGCCTGG - Intergenic
1041220553 8:55647198-55647220 AGAGGTCAACATTCAAATCCAGG - Intergenic
1042155394 8:65840785-65840807 AGTCTGCAAAGTTCATAGCCAGG - Intronic
1042537833 8:69876810-69876832 AATGTACAAAATTCAGAGCCGGG + Intergenic
1044526754 8:93261071-93261093 AATTGTCAAAATCCATGGCCTGG - Intergenic
1045175822 8:99723799-99723821 TGTGGGCAAAATTCAAAGACAGG + Intronic
1046089195 8:109478821-109478843 AGTGATGAAAATTCATACCATGG - Intronic
1047950562 8:129930660-129930682 AGTAGTCAAAATATGTAGCCTGG - Intronic
1049322182 8:142002417-142002439 ACTGGGCAAAATCCATAACCTGG - Intergenic
1050848708 9:10257447-10257469 AGAGAGAAAAATTCATAGCCAGG + Intronic
1051757720 9:20422653-20422675 AATTGTCAGAATTCATAGTCAGG - Intronic
1055448191 9:76404534-76404556 ATTGGTCAAATTTCACAACCAGG - Intergenic
1058198614 9:102009930-102009952 AGAGGCCAAAATTCAAATCCTGG + Intergenic
1058703240 9:107618375-107618397 AGTGCTCATAACACATAGCCTGG + Intergenic
1186247817 X:7632492-7632514 AGTGGTTAAAAATCATTGCTGGG - Intergenic
1187121743 X:16415363-16415385 TTTGGTCAAAATGAATAGCCTGG + Intergenic
1187819579 X:23272549-23272571 AGTAGTCAAAACTCATAGTTTGG + Intergenic
1192311141 X:70015034-70015056 AGAGGCCAACATTCAAAGCCAGG + Intronic
1194272955 X:91842018-91842040 ACTGGTCCAAACTCATACCCTGG - Intronic
1197236354 X:124069427-124069449 AGTGTCCAAAAATCATAGTCAGG - Intronic
1197624765 X:128789533-128789555 AGAGGTCAACATTCAAACCCAGG + Intergenic
1199068456 X:143448045-143448067 AGAGGTTAATATTCACAGCCAGG - Intergenic
1199132162 X:144202448-144202470 AGAGGTCAACATTCATATCCAGG - Intergenic
1200590198 Y:5063426-5063448 ACTGGTCCAAACTCATACCCTGG - Intronic