ID: 959556535

View in Genome Browser
Species Human (GRCh38)
Location 3:107725855-107725877
Sequence GAGGTGAATTTTCATTTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959556530_959556535 23 Left 959556530 3:107725809-107725831 CCTCATCTAATTGGTTGGAAATT 0: 1
1: 0
2: 1
3: 16
4: 171
Right 959556535 3:107725855-107725877 GAGGTGAATTTTCATTTAATGGG 0: 1
1: 0
2: 1
3: 28
4: 257
959556527_959556535 29 Left 959556527 3:107725803-107725825 CCCTTACCTCATCTAATTGGTTG 0: 1
1: 0
2: 1
3: 7
4: 143
Right 959556535 3:107725855-107725877 GAGGTGAATTTTCATTTAATGGG 0: 1
1: 0
2: 1
3: 28
4: 257
959556528_959556535 28 Left 959556528 3:107725804-107725826 CCTTACCTCATCTAATTGGTTGG 0: 1
1: 0
2: 0
3: 9
4: 68
Right 959556535 3:107725855-107725877 GAGGTGAATTTTCATTTAATGGG 0: 1
1: 0
2: 1
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959556535 Original CRISPR GAGGTGAATTTTCATTTAAT GGG Intronic
900510768 1:3059821-3059843 GAGGGTAATTTTCATTTTAGAGG - Intergenic
908174483 1:61540941-61540963 ACCGTGAATTTTCAGTTAATAGG - Intergenic
908236614 1:62153293-62153315 GAGAGGGAATTTCATTTAATTGG - Intronic
908380760 1:63594457-63594479 GAGCTGAATTTTCATTAGAATGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909097656 1:71308569-71308591 GAGGTAAATCATCTTTTAATAGG + Intergenic
909464966 1:75963339-75963361 GAGGAGAATTTGGATTAAATTGG - Intergenic
909958436 1:81804169-81804191 GAAGTAAATTTTCTTTTAAAGGG - Intronic
910122951 1:83810480-83810502 GAGGAGAAATTTCATTAAAGAGG - Intergenic
911081529 1:93936992-93937014 GAGGTGATGTTTCATTAAACAGG + Intergenic
911450147 1:98052033-98052055 GAGATGAATATTTATGTAATAGG - Intergenic
911563036 1:99429723-99429745 GAAGTGAATTTTCTTTCATTAGG - Intergenic
911885755 1:103297011-103297033 CAGATAAATTTTCATTTATTTGG - Intergenic
913834132 1:123300270-123300292 GAGTTGAACTTTCATTTAGAGGG + Intergenic
913867528 1:123899303-123899325 GAGTTGAACTTTCATTTAGAGGG + Intergenic
913896085 1:124410930-124410952 GAGTTGAAATTTCATTTAGAGGG + Intergenic
913901614 1:124510173-124510195 GAGTTGAACTTTCATTTAGAGGG + Intergenic
913903143 1:124537689-124537711 GAGTTGAAATTTCATTTAGAGGG + Intergenic
915531596 1:156505353-156505375 GCGGTTAATTTGCATTTAAAGGG - Intergenic
915665837 1:157444046-157444068 AAGGTGAATTTTCACTTATGTGG - Intergenic
916334102 1:163650608-163650630 GAGGAGAATTTTCTGTTCATGGG - Intergenic
918072525 1:181143386-181143408 GAATTGCATTTTCATTTAACAGG - Intergenic
918389299 1:184041108-184041130 GAGCTGAATTTTCATTTCACTGG + Intergenic
918872711 1:189997226-189997248 GAGATGAAGTTTCATCTTATCGG - Intergenic
919851087 1:201673453-201673475 GAGGTCAATTTTCATTTTTTGGG - Intronic
920282037 1:204851071-204851093 GAAGTGGATTTTCATTTACTGGG + Intronic
920446394 1:206021814-206021836 TAGGGGAAGTTTAATTTAATTGG - Intronic
921273094 1:213490226-213490248 GACCTGAGTTTTCATTCAATAGG - Intergenic
921687647 1:218108476-218108498 GAGGTACATTTTCATTTGAAGGG + Intergenic
921977990 1:221224092-221224114 GTGCTGAATTTTGTTTTAATAGG + Intergenic
924309635 1:242726672-242726694 GATGGTAATTTTCATTTAGTGGG - Intergenic
924427761 1:243968994-243969016 GAAGTGAATTTTAATTTAAGAGG - Intergenic
924518610 1:244786741-244786763 TAGTTAAATTTTTATTTAATAGG + Intergenic
1063249427 10:4257863-4257885 GAGGCAAATCTTCATTTAAAAGG + Intergenic
1065185784 10:23170091-23170113 GAGGTCACTTTTCATTTTATGGG + Intergenic
1067130373 10:43558759-43558781 TAAGTAAATTTGCATTTAATTGG + Intronic
1068614440 10:59097344-59097366 GACGTCAATTTGCATTTAGTTGG + Intergenic
1071018240 10:81022817-81022839 GAGTTGAAATTTTATTTAAAGGG + Intergenic
1073048691 10:100654546-100654568 TAGATGAATTTTCATTTTATAGG - Intergenic
1075859611 10:125663005-125663027 TATGGGAATTTTCATTGAATTGG - Intronic
1076143383 10:128097151-128097173 CAAGTGAATTTCCATGTAATAGG - Exonic
1078273480 11:9819498-9819520 GTGCTGAAATTTCATTTAACAGG - Intronic
1079412720 11:20204593-20204615 AAGGTGAAATTTCACTTATTTGG + Intergenic
1079623633 11:22587915-22587937 GCGGTGAATTTTCACTGCATTGG - Intergenic
1082156954 11:48833751-48833773 GAGTTGAACTTTCTTTTGATAGG + Intergenic
1082432161 11:52684182-52684204 GAGGTGAACATTCCTTTAGTTGG + Intergenic
1082567974 11:54703109-54703131 CAGGTTAATTTTCATTAATTAGG + Intergenic
1087148449 11:94835549-94835571 GAAATGAAATTTCATTTTATTGG + Intronic
1087539206 11:99493405-99493427 CATGTGTATTTTCATTTTATAGG + Intronic
1088213941 11:107486573-107486595 GATGTGTTTTTTCTTTTAATAGG - Intergenic
1090803075 11:130186578-130186600 GCTGTGAATTTTCATTGACTGGG - Intronic
1090942062 11:131395659-131395681 GAGGTGAATTAACATTTAAAAGG - Intronic
1093420870 12:18973043-18973065 GAGGTGTTTTTTTCTTTAATAGG - Intergenic
1093703723 12:22251792-22251814 GAAGTGAATATTCTTTGAATTGG + Intronic
1094881232 12:34783881-34783903 GAGTTGAACCTTCTTTTAATTGG + Intergenic
1096643804 12:53016664-53016686 GATGTGAATTATTATGTAATAGG - Intronic
1096925792 12:55144357-55144379 GTGATAACTTTTCATTTAATGGG - Intergenic
1098266369 12:68724975-68724997 GAGGTGACATTTCATTTCAGAGG + Intronic
1099850130 12:88083779-88083801 GAGCTGAATTTTAATTTACATGG + Intronic
1101130250 12:101682710-101682732 AAGGTGCATTTTCATGTAAGAGG - Intronic
1106001627 13:25728972-25728994 GAGGAAAATCTCCATTTAATAGG - Intronic
1106337572 13:28797575-28797597 GTGGTGACTTTTAATTTTATTGG + Intergenic
1106979372 13:35258669-35258691 GTGTTTATTTTTCATTTAATTGG + Intronic
1107121677 13:36803030-36803052 GGGGTTAATTTCCATTTCATGGG - Intergenic
1108160679 13:47635171-47635193 CAGGTTAATTTCCATGTAATTGG - Intergenic
1109571600 13:64199293-64199315 AATGTGAATTTTAATTAAATAGG + Intergenic
1110197267 13:72804614-72804636 AAGGGGAATTTTCATTTATGTGG + Intronic
1110757886 13:79197341-79197363 GAGGTGAATTTCAACTTCATGGG - Intergenic
1111173128 13:84556124-84556146 TAGCTGAAATTTCAATTAATAGG + Intergenic
1111304288 13:86385807-86385829 AAAGTGATTTTGCATTTAATTGG + Intergenic
1112146002 13:96700974-96700996 GAGGTGAATCTTCACTAACTGGG - Intronic
1113996768 14:16090481-16090503 GAGGTGAACTTTCTTTTGATTGG - Intergenic
1116227055 14:42165915-42165937 ATGCAGAATTTTCATTTAATGGG + Intergenic
1116612081 14:47088556-47088578 GTGGTGAATTTCCAGTTACTGGG - Intronic
1119131949 14:72181149-72181171 GATGTGAATTATAATTAAATGGG - Intronic
1120000809 14:79301342-79301364 GAGGAGAAATTTGATTTCATCGG + Intronic
1120612124 14:86655007-86655029 GAGGTGAATGTGCTCTTAATGGG - Intergenic
1120649504 14:87114669-87114691 AAGGTGTATTTTAGTTTAATAGG - Intergenic
1123227218 15:17051655-17051677 GAGTTGAACTTTCTTTTGATTGG + Intergenic
1123456378 15:20430198-20430220 GAGGTGAAGGTTCATTTTAAAGG - Intergenic
1124315487 15:28664392-28664414 GAGGTGAAGGTTCATTTTAAAGG + Intergenic
1125307929 15:38343143-38343165 GAGATGAATTTGAATTTTATTGG - Intronic
1125780638 15:42263399-42263421 GTGGGGAATTTTTGTTTAATAGG + Intronic
1126587518 15:50303814-50303836 TAAGACAATTTTCATTTAATGGG + Intronic
1127350932 15:58151445-58151467 TAGATGAATTATCATTTAATTGG - Intronic
1129074510 15:72980921-72980943 CAGATGAATTTTTATTCAATAGG - Intergenic
1129083519 15:73063860-73063882 AAAGTTAATTTTCATTAAATTGG - Intronic
1129625204 15:77190139-77190161 AAGGTAAAATTTCTTTTAATTGG - Intronic
1129658129 15:77538059-77538081 GAGGTGAAGGCTCATTTAAATGG + Intergenic
1130612653 15:85375668-85375690 GAGCTGAATTTTTATTTCTTGGG - Intergenic
1131770815 15:95735569-95735591 GAAGTGTAGTTTTATTTAATGGG - Intergenic
1131884413 15:96896084-96896106 GAGTTGCATGTTCATTTAAAAGG - Intergenic
1133624200 16:7555115-7555137 GAGATGCATTGTAATTTAATGGG - Intronic
1136590085 16:31213462-31213484 CAGCTGAAATTTCATTTAAGTGG - Intergenic
1137243765 16:46685021-46685043 GAGGGGAATAATCACTTAATGGG + Intronic
1137873810 16:51976174-51976196 GAAGTGCATTTTCTTTTAATAGG - Intergenic
1139869362 16:70092758-70092780 GAGGAGATTTTTCATTTTAAAGG + Intergenic
1140331083 16:74057522-74057544 GAGGGGAGTTGCCATTTAATGGG + Intergenic
1140386021 16:74539455-74539477 GAGGAGATTTTTCATTTTAAAGG - Intronic
1140644361 16:77013150-77013172 GAGCTGAATCTTCATTACATAGG - Intergenic
1144099721 17:11932901-11932923 GAGGTGAATATTCCCTTAACTGG - Intronic
1148003791 17:44408371-44408393 GAGATGAAGTTTCATTTTCTTGG + Intronic
1149733494 17:58970224-58970246 GAGCTGATTTTTCTCTTAATAGG + Intronic
1149913083 17:60584020-60584042 GAGCTGAATCTGCATTTAATAGG + Intronic
1150731200 17:67696094-67696116 GAGGAAAATTTTAATTTATTTGG + Intronic
1153159740 18:2190395-2190417 GAAGTGAAGTTTCAGTTAAATGG - Intergenic
1154134347 18:11762537-11762559 GAGCTGAATCTTCCTTGAATGGG + Intronic
1154345872 18:13543140-13543162 GGGGTGGATTTAGATTTAATTGG - Intronic
1156317089 18:35980034-35980056 GAGGGGAAATTTCAATTAAGAGG + Intergenic
1156718381 18:40040189-40040211 GCTGTGAACATTCATTTAATGGG + Intergenic
1156908980 18:42388486-42388508 GAGTAGAACTTCCATTTAATGGG + Intergenic
1157787392 18:50496550-50496572 GAAGTGAATCTTCTTTTCATGGG - Intergenic
1158995385 18:62913056-62913078 AAGATGAATTATCATTTAAGAGG - Intronic
1159036919 18:63286418-63286440 TAGGTTAATTTTCATTGAAGGGG + Intronic
1159169194 18:64741463-64741485 GAAGTGACCTTTCATTTAATAGG + Intergenic
1160321281 18:77897991-77898013 GAAGTGCATTTTCATATAAATGG - Intergenic
926288824 2:11512376-11512398 TAAGTGAATTTTTACTTAATAGG - Intergenic
926410250 2:12595305-12595327 AAGGTGAGTTCTCATTTTATAGG + Intergenic
927508559 2:23630093-23630115 GAGGCGATTGTTCATTTAAAGGG + Intronic
928821732 2:35369842-35369864 GACGTGTGTTTTCATTTTATGGG - Intergenic
928835444 2:35538849-35538871 GAGTTATATTTTCATTTTATAGG - Intergenic
929724075 2:44405818-44405840 GAGTTGAATATACATTTCATAGG - Intronic
929929428 2:46240619-46240641 GGGATGCAGTTTCATTTAATGGG + Intergenic
930200447 2:48547761-48547783 GAGGTTAATTTGCGGTTAATAGG + Intronic
930600139 2:53433204-53433226 TATGTGTGTTTTCATTTAATTGG - Intergenic
931495662 2:62804491-62804513 GAAGTGAATATTTATTAAATCGG + Intronic
932314702 2:70772181-70772203 GAGGTGAACTTTCATTTATTGGG - Intergenic
933040780 2:77463431-77463453 GAGGAAAATTTTGATTTACTGGG - Intronic
933200761 2:79445557-79445579 GAAGTTAATTTTCACTTAAATGG - Intronic
934103553 2:88675899-88675921 GAGTTCAACTCTCATTTAATAGG + Intergenic
934660430 2:96140583-96140605 GAGGGGAGTTATCATTTAATAGG + Intergenic
935317861 2:101854889-101854911 GAAGTTAATTTTAATTTAAATGG - Intronic
938870699 2:135473132-135473154 CATGAGAATTATCATTTAATGGG - Intronic
939113546 2:138035125-138035147 GAGGAAAATTCTCATTTTATAGG - Intergenic
939169004 2:138672302-138672324 GAGGTATATTTTGAATTAATAGG + Intronic
939510429 2:143097976-143097998 TAGATGAGTTATCATTTAATTGG + Intronic
939782834 2:146470513-146470535 GATATGAATTTTTATTTCATGGG + Intergenic
940686700 2:156859428-156859450 GGGGTGAATTTTCATTTACCTGG + Intergenic
940839624 2:158564824-158564846 AAGGGGAAATTTCATTCAATGGG - Intronic
942634643 2:177990244-177990266 CAAGTGAATTTTCATTGACTAGG - Intronic
942635837 2:178004504-178004526 GTGGTGAATTGTTATTTACTGGG - Intronic
943230741 2:185247743-185247765 GAAGTCAATTTTCCTTTAAAAGG - Intergenic
943387636 2:187222498-187222520 GTGGTTTATTTTCCTTTAATGGG - Intergenic
945779363 2:214149245-214149267 GAGGTGAATTTTGATTCATCAGG + Exonic
948190422 2:236053939-236053961 GAGGTGAACTTACAAATAATGGG - Intronic
1169722710 20:8696629-8696651 GAGATGTATTTCCATTTATTTGG + Intronic
1170343819 20:15360339-15360361 GATGTAAATTTTCATTTATCTGG + Intronic
1170629346 20:18055013-18055035 CAGGGGAATTTTTATTTACTGGG - Intronic
1171743092 20:28927693-28927715 GAGTTGAACTTTCTTTTGATTGG - Intergenic
1172171629 20:32938778-32938800 GAGATGTATTTCCATTTATTTGG - Intronic
1175498170 20:59429464-59429486 TAGGTTGATTTGCATTTAATAGG + Intergenic
1176910218 21:14556532-14556554 AAGGTGGAATTCCATTTAATTGG - Intronic
1177278632 21:18949813-18949835 GATGTGAATTTTCATTTCTCTGG + Intergenic
1177701560 21:24645710-24645732 GATGAGAAATTTAATTTAATGGG + Intergenic
1178015901 21:28345811-28345833 GAGGTCAATTTTAATGTCATAGG - Intergenic
1180310155 22:11216795-11216817 GAGGTGAACTTTCTTTTGATTGG + Intergenic
1183239002 22:36641871-36641893 GAAATGAATTTTTATTTCATTGG + Intronic
949208639 3:1471466-1471488 GGGAAGAATTTTCATTTAAGTGG + Intergenic
957451742 3:80389125-80389147 GAGGTGAGTTTTTATTAAAGAGG - Intergenic
957452369 3:80396140-80396162 GAGCTGAATACTGATTTAATTGG - Intergenic
957493233 3:80956878-80956900 AAGGTGTATTTTGATTTACTAGG - Intergenic
958562774 3:95769198-95769220 GAGATAAATTTATATTTAATAGG + Intergenic
958706369 3:97661723-97661745 GAGGTTTATTTTCATTTCAGTGG + Intronic
959556535 3:107725855-107725877 GAGGTGAATTTTCATTTAATGGG + Intronic
960299156 3:115980947-115980969 GAGGTGAATTGTCGTTTCACTGG + Intronic
962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG + Intronic
963203962 3:142613807-142613829 GAGGAGAATTTTTATGTAACAGG - Intronic
964537028 3:157734107-157734129 AGAGAGAATTTTCATTTAATTGG - Intergenic
964946248 3:162228582-162228604 GAGCTGAATTTTACTTTAACAGG + Intergenic
965238481 3:166160216-166160238 TAGGTGAGTTATCATTGAATTGG + Intergenic
965593497 3:170384848-170384870 GAGCTAAATTTTCAGATAATTGG + Intronic
965667374 3:171109866-171109888 GAGGCTAATTTTTACTTAATAGG + Intronic
966315654 3:178642833-178642855 GAGGTGACTGGTCATTTAAGGGG + Intronic
966654223 3:182335884-182335906 GTGGTGATTTTTAATTTAAGTGG - Intergenic
967467581 3:189825080-189825102 GAGATGAATGTTCTTGTAATAGG + Intronic
967650852 3:191984853-191984875 GATTTGACTTCTCATTTAATAGG - Intergenic
967993802 3:195151745-195151767 TATGTGAAGTTCCATTTAATTGG + Intronic
969169685 4:5350057-5350079 TTGGAGAATTTTCATTAAATAGG - Intronic
969215286 4:5716940-5716962 GTGGTGCAATTTCATTTACTAGG - Intronic
970076945 4:12233174-12233196 CAGGTGCATTTTCATATACTGGG - Intergenic
970705250 4:18793900-18793922 GCTTTGAAATTTCATTTAATTGG - Intergenic
970953376 4:21782370-21782392 AAGATGAATTTTCATTTATTTGG - Intronic
971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG + Intergenic
974835595 4:67245765-67245787 GGGGTGAGTTTTTTTTTAATTGG + Intergenic
975147456 4:70984889-70984911 GAGGTTAATTTACCTTAAATTGG + Intronic
976882804 4:89949378-89949400 CAGGAGAAGTTTCAATTAATGGG - Intronic
978165234 4:105599118-105599140 TATGTGAATTTTCTTTTTATGGG + Intronic
978198344 4:105996146-105996168 TAGGTGAATTTTTATTTATTTGG + Intronic
978971515 4:114813030-114813052 AAGGCAAATTTTCTTTTAATAGG - Intergenic
983024724 4:162720806-162720828 GATGTGTGTTTTCATTTCATTGG - Intergenic
983108130 4:163715610-163715632 GAGGTGAATTTTAATCTCAGTGG + Intronic
985915053 5:2911144-2911166 GTGGTGAATTTTTATTCCATCGG + Intergenic
986417130 5:7540387-7540409 GAGGTTAGTTTTTATCTAATTGG + Intronic
986479618 5:8173404-8173426 GAAATGAACTTTTATTTAATAGG - Intergenic
986780060 5:11057223-11057245 GAGGAGTATATTCATCTAATGGG + Intronic
987204121 5:15607588-15607610 GAAGATAATGTTCATTTAATGGG - Intronic
987963458 5:24840905-24840927 CAGATAAATTTTCATTTAATGGG + Intergenic
988295733 5:29359099-29359121 GAGGTGAATTTTATATAAATAGG + Intergenic
988880028 5:35492082-35492104 GATGTGTACTTTCATTTAATGGG - Intergenic
989216588 5:38910573-38910595 CAGGTTAATTTCCATGTAATCGG - Intronic
989969843 5:50510325-50510347 GATGTGCATGTTCAGTTAATTGG + Intergenic
990167283 5:53008750-53008772 GATGTGCATTTTCATTGACTTGG + Intronic
990378319 5:55195807-55195829 CAGGTGATTTTTAAATTAATTGG - Intergenic
990511103 5:56489779-56489801 GAGGAGCATTGTCATTTAGTAGG + Intergenic
990716873 5:58647112-58647134 GAGCTGACTTTACTTTTAATTGG - Intronic
990728254 5:58780251-58780273 GAGGGGATGTCTCATTTAATTGG - Intronic
991004769 5:61816965-61816987 CAGGTGAATTTTCATGCACTAGG + Intergenic
991179034 5:63727247-63727269 AAGGTGGATTTTAATTTATTTGG + Intergenic
991293085 5:65051524-65051546 AAGCTGACTTTTCATTTAATTGG + Intergenic
992842804 5:80712624-80712646 GAATTTAATTTTCTTTTAATAGG + Intronic
993538129 5:89113069-89113091 GAGGTAAAATGTCCTTTAATGGG - Intergenic
994542982 5:101123384-101123406 TAGGTAAATTTTAATTTAAATGG + Intergenic
994757104 5:103807812-103807834 TACTTGAATTTTCATTTACTTGG - Intergenic
994807406 5:104467916-104467938 GAGATGCCTTTTCATTTAGTTGG + Intergenic
998076538 5:139241246-139241268 GATAAGAATTGTCATTTAATAGG + Intronic
998455184 5:142266590-142266612 GAGATTAATCTTCAATTAATAGG - Intergenic
999024353 5:148209063-148209085 TTGGTGAATTTTCATACAATTGG + Intronic
999057912 5:148600867-148600889 GGGTTGCATTTTCATTTATTTGG - Intronic
1000481348 5:161779181-161779203 GAGGTGTATTTTCTGTTATTAGG - Intergenic
1004880408 6:20001929-20001951 GAGCTGTATTTTTCTTTAATAGG + Intergenic
1005231608 6:23708352-23708374 TAGGTGGATTTTCACTTTATTGG + Intergenic
1006996503 6:38266271-38266293 GCTGAGAATTTTCATTAAATTGG - Intronic
1008633821 6:53389516-53389538 GAGGTCAATTTTATTTTGATAGG - Intergenic
1008812910 6:55526801-55526823 GAGGTGAATCCCCATTTTATGGG - Intronic
1010839606 6:80633360-80633382 GAATTAAATTTACATTTAATGGG + Intergenic
1011050221 6:83139167-83139189 GAGGTGATTTTTAACTTTATTGG + Intronic
1012253807 6:97009081-97009103 CAGGTGAGTTGTCACTTAATGGG + Intronic
1013991304 6:116257397-116257419 AAGGTGGCTTTTCATTTTATGGG - Intronic
1014462320 6:121711416-121711438 GAAGTACATTTTCATTTACTTGG + Intergenic
1014484995 6:121987472-121987494 GAGTGGAATTGTCATTTCATAGG + Intergenic
1014791008 6:125672280-125672302 GAGGTGAAATTTCATGACATTGG + Intergenic
1015458020 6:133451393-133451415 GAAGTAAATTTTCATATAATTGG - Intronic
1016361356 6:143270710-143270732 GAGCTTTAATTTCATTTAATAGG + Intronic
1016520692 6:144943492-144943514 GAGTTGATTTTTCATTTATCCGG + Intergenic
1017017010 6:150109480-150109502 GAGATTAATTTTATTTTAATAGG + Intergenic
1020578186 7:9960935-9960957 TAGCTGAATTTTCATATAGTAGG + Intergenic
1021516475 7:21493345-21493367 ATGGTGTATTTTCATTTAATTGG - Intronic
1022114273 7:27248792-27248814 CAGGCGTATTTTCAGTTAATAGG + Intergenic
1027392693 7:77721153-77721175 GAGATAATTTTTAATTTAATTGG + Intronic
1028356572 7:89917402-89917424 TAGGTGAACATTCATTTTATTGG + Intergenic
1030090614 7:105854560-105854582 GAGGTTAGTTTTCATATGATGGG - Intronic
1030487224 7:110184877-110184899 GAGCTGATTTTCCATTTATTAGG + Intergenic
1030574554 7:111269770-111269792 GTGGTGAGTTTGCATTTGATAGG - Intronic
1030625118 7:111836732-111836754 GAGATGAATATTAATTGAATGGG + Intronic
1030791586 7:113736296-113736318 GAGGTGAAAATTCAGTTCATTGG + Intergenic
1031203301 7:118719747-118719769 GAGATGATTAATCATTTAATAGG - Intergenic
1031532586 7:122894060-122894082 TAAGTGAATTTTAATGTAATCGG + Intergenic
1032273694 7:130435745-130435767 GATGTTAATTTTCATTTATCTGG - Intronic
1036674718 8:10820980-10821002 GAAGTGAATTTTAAATTAGTTGG - Intronic
1038202238 8:25423955-25423977 CAAGTTAATTTTCATTTGATGGG + Exonic
1038221167 8:25609248-25609270 GAGATGATTCTTCATTTAATGGG - Intergenic
1041483641 8:58350082-58350104 GAGGGGAGTTATCATTTAATGGG - Intergenic
1042037046 8:64544940-64544962 GAAGTGCTTTTTCATTTCATTGG - Intergenic
1042158944 8:65872703-65872725 AAGGTGTATTTTGCTTTAATAGG - Intergenic
1042605301 8:70540111-70540133 AATGTGAATATTCAGTTAATAGG - Intergenic
1042943269 8:74128884-74128906 GAGGTTTATTTTCATATAAGCGG + Intergenic
1043409582 8:79979431-79979453 GACTTCAGTTTTCATTTAATTGG - Intronic
1044978204 8:97687811-97687833 AAGGCAAATTTTAATTTAATAGG - Intronic
1045771971 8:105752913-105752935 GAGTAGAATTTTCTTATAATTGG + Intronic
1046966773 8:120176417-120176439 GAGGTATATTTTCACTTACTGGG + Intronic
1047227524 8:122969249-122969271 GTGGGGAATTTTCATACAATGGG + Intronic
1050189386 9:3009126-3009148 GAGCTAAATTTTATTTTAATCGG + Intergenic
1050383431 9:5057517-5057539 ATGGTGAGTTTTTATTTAATGGG - Intronic
1051691486 9:19717857-19717879 TAGTGGAATTTTCATTTAGTGGG - Intronic
1052778143 9:32753870-32753892 GAGGTGAATTTACATTTTCAAGG - Intergenic
1055596038 9:77865031-77865053 GGGGTTAATTTTCTTTTAGTAGG - Intronic
1056298680 9:85220000-85220022 GAGATGAATTTTAATTTGTTTGG + Intergenic
1056343877 9:85670341-85670363 GATGTGAATTTTAAATAAATAGG + Intronic
1058279446 9:103094175-103094197 GACCTGAATTTTCAATTAATTGG - Intergenic
1058343565 9:103928711-103928733 TAGGGCAATTTCCATTTAATAGG - Intergenic
1203381997 Un_KI270435v1:60444-60466 GAGTTGAACTTTCTTTTGATTGG + Intergenic
1203401452 Un_KI270519v1:104900-104922 GAGTTGAACTTTCTTTTGATTGG + Intergenic
1186010017 X:5119823-5119845 AAGGTTAATTTTTATTTAAGAGG + Intergenic
1186807208 X:13152346-13152368 GGGCTGAATTTTGATTTAAAAGG + Intergenic
1187668441 X:21642524-21642546 GATGTGAAATTTCCTTTAGTTGG + Intronic
1188417948 X:29959600-29959622 GAGGTGAAATATTATTAAATAGG + Intergenic
1188727156 X:33599917-33599939 GATGTGAATGTTAAGTTAATTGG - Intergenic
1190649540 X:52555659-52555681 GTGGTGAAGCTTCATTTCATAGG - Intergenic
1190683718 X:52851851-52851873 GTGGTGAAGCTTCATTTCATAGG - Intergenic
1191721672 X:64235082-64235104 ATGGGGAATTTTTATTTAATGGG - Intergenic
1192090397 X:68149204-68149226 GTGGTGATTTTTCATTTGGTTGG - Intronic
1193408364 X:81132316-81132338 AATGTGAATTGTAATTTAATGGG - Intronic
1194569503 X:95536690-95536712 GAGGTGTATTTTTGTTTGATAGG + Intergenic
1196943060 X:120796787-120796809 AAGGGGATTTTTCATTTACTTGG - Intergenic
1197329102 X:125131886-125131908 GAGGTGAAATTGCATTAAAGCGG + Intergenic
1199089843 X:143678923-143678945 GAGGTGAATGTACATTTTATTGG + Intergenic
1199204446 X:145132011-145132033 GATGTAAATATTCATTTCATGGG - Intergenic