ID: 959557091

View in Genome Browser
Species Human (GRCh38)
Location 3:107733040-107733062
Sequence CAGTATGAGCAGAGTGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959557091 Original CRISPR CAGTATGAGCAGAGTGGAGA CGG (reversed) Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900398757 1:2464247-2464269 GAGTAAGGGCAGAGTGGGGAGGG - Intronic
900623227 1:3596726-3596748 CTGTAGGAGCAGGGTGGAGACGG - Intronic
900719560 1:4166566-4166588 GAGAAGGAGCAGAGTGGAGGTGG - Intergenic
900760981 1:4470166-4470188 CATTTTGAGCTGAGTGAAGATGG + Intergenic
900821490 1:4892825-4892847 CAGGGTGAGAAGAGTGCAGAAGG - Intergenic
901032249 1:6314029-6314051 CAGAATGAGCAACGTGGAGGAGG + Intronic
901785601 1:11622541-11622563 TAGGAGGTGCAGAGTGGAGAAGG - Intergenic
901882824 1:12204108-12204130 CAGAAGGGGCAGAGGGGAGAGGG - Intronic
902105552 1:14032966-14032988 CAGTAAGACCAGGGTGCAGAGGG - Intergenic
903050127 1:20594450-20594472 CACAAAGAGGAGAGTGGAGATGG + Intronic
904663088 1:32099648-32099670 CAGCATGAGCTGTGTGGTGAGGG + Intronic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904844926 1:33403692-33403714 TAATTTTAGCAGAGTGGAGATGG - Intronic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
908166602 1:61464965-61464987 AAGTAGGACCTGAGTGGAGAGGG + Intergenic
909456370 1:75854316-75854338 CAGCATAGGCAGAGTGAAGATGG - Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910627981 1:89328421-89328443 CATTAAAAGCAGAGTGTAGAGGG + Intergenic
912469686 1:109898021-109898043 CAGCAAAAGCAAAGTGGAGAGGG - Intergenic
913576765 1:120183098-120183120 CACTATGAGTAGAGGAGAGATGG - Intergenic
914558674 1:148794533-148794555 CACTATGAGTAGAGGAGAGATGG - Intergenic
914614161 1:149335697-149335719 CACTATGAGTAGAGGAGAGATGG + Intergenic
916346089 1:163792930-163792952 CAGTATTAGCAGACTAGAGCTGG - Intergenic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
917335907 1:173924167-173924189 CAGGAGAAGCATAGTGGAGAGGG - Intergenic
917568402 1:176235895-176235917 CAGTATGGGAAGAGGGGTGATGG + Intergenic
917618369 1:176769209-176769231 CAGTGTCAGCAGCCTGGAGAGGG - Intronic
917704582 1:177619295-177619317 CAGTTTCAGCAGAGTAGTGAGGG + Intergenic
917727160 1:177839019-177839041 CAGTATGTCCATGGTGGAGAGGG + Intergenic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
920191947 1:204199257-204199279 CCCTAGGAGCAGAGGGGAGAAGG + Exonic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923904665 1:238370548-238370570 CAGTATGGGAAGAGAGTAGAGGG - Intergenic
924148860 1:241107148-241107170 CACAAGGAGCAGAGTGGAGGGGG - Intronic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1070443602 10:76471038-76471060 CAGTAACAGCACAATGGAGATGG + Intronic
1070905977 10:80073496-80073518 CAGTATAATGAGAATGGAGAAGG - Intergenic
1071191322 10:83104789-83104811 CAGTATGAGCAGAGTGCCTTGGG - Intergenic
1071888131 10:89972722-89972744 CAATGGGAGCAGAGAGGAGAAGG + Intergenic
1071964214 10:90835734-90835756 CAGCATGATGAGAGTAGAGAAGG + Intronic
1072551030 10:96477878-96477900 CAACATCAGCAGAGAGGAGATGG - Intronic
1073295659 10:102436861-102436883 CAGCATGAGAAGTGTGGAGCCGG - Intergenic
1074290523 10:112135118-112135140 CAGTAGTGGGAGAGTGGAGAGGG + Intergenic
1074537954 10:114342279-114342301 AGGTATGAGCAGGGAGGAGAGGG - Intronic
1074838026 10:117317933-117317955 AATTTTGATCAGAGTGGAGAAGG - Intronic
1076560364 10:131359125-131359147 CAGGAAGAGCAGTGTGGGGAGGG - Intergenic
1076677759 10:132156279-132156301 CAGCATGAGCAGGATGGAGGAGG - Intronic
1076869224 10:133185174-133185196 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869226 10:133185197-133185219 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869236 10:133185335-133185357 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869242 10:133185404-133185426 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869247 10:133185473-133185495 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076987970 11:253091-253113 CTGTATGTGCAGGGAGGAGAAGG - Intergenic
1077167479 11:1150354-1150376 CAGCATGTGCACAGTGGAGCAGG + Intergenic
1077414777 11:2420011-2420033 CTGTCTGGGCAGAGTGGTGAAGG - Intronic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1079206448 11:18419184-18419206 CTGTAAGAGCAGAGTTGAGTAGG - Intronic
1079666632 11:23113919-23113941 AAGTAGAGGCAGAGTGGAGAGGG + Intergenic
1080999293 11:37648017-37648039 CAGTAAGAGAAGAGTGGGTAAGG + Intergenic
1081390874 11:42527181-42527203 CAGTATGGACAGAGCAGAGAAGG + Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1083229489 11:61306949-61306971 CAATTTGAGTAGAGTGGAAAAGG - Intronic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084298160 11:68226499-68226521 CAACTTGAGGAGAGTGGAGAAGG + Intergenic
1084472283 11:69370007-69370029 CAGAATAGGCAGAGAGGAGAAGG + Intergenic
1084605189 11:70168185-70168207 CAGCATGTGCAGAGTGCAGGAGG - Intronic
1085861540 11:80241745-80241767 CAATATGTGCAGATTGGGGAAGG - Intergenic
1086556049 11:88112246-88112268 CAGCATGATCTGAGTGGAAAAGG - Intergenic
1087899111 11:103620892-103620914 CAGTCCTGGCAGAGTGGAGAAGG + Intergenic
1088146407 11:106685678-106685700 CAGTATGAGCAGAGCAGACTGGG - Intronic
1088835128 11:113571449-113571471 CTGCATGAGTAGACTGGAGAAGG + Intergenic
1089996208 11:122910171-122910193 CAGTATGTTAAAAGTGGAGAGGG + Intronic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090919480 11:131195443-131195465 TAGTATTATCAGAGTGTAGAGGG - Intergenic
1091419024 12:318868-318890 GAGAATGACCAGAGTGGGGAAGG + Intronic
1092000895 12:5031276-5031298 CAGGATGAGAAGAGGGGAAAAGG + Intergenic
1092213385 12:6663044-6663066 CAGTAAGAGCAGGCTGGAGGTGG - Exonic
1092213585 12:6664653-6664675 CAGTAAGAGCAGGCTGGAGGAGG + Intergenic
1092791672 12:12076057-12076079 CAGTACAAGCAGAATGGACAGGG + Intronic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1092906516 12:13104667-13104689 CTGTATGAGCAAAGAGGAAATGG - Intronic
1094713843 12:32991774-32991796 CAGTCTGAGCAGTATGGGGAGGG + Intergenic
1096080765 12:48830855-48830877 CAGTAGGAGGACAGGGGAGATGG - Intronic
1096278191 12:50228790-50228812 CAGTAAAAGCAGATTAGAGAGGG - Intronic
1096452512 12:51756186-51756208 CAGCATGAGCAGGGTGACGAGGG - Intronic
1096574523 12:52544428-52544450 CAGGACCAGCAGGGTGGAGATGG + Exonic
1097618723 12:61914366-61914388 CAGTGGGAGCAGTGTGGTGAAGG - Intronic
1098948255 12:76611591-76611613 CTGTAAGAGCAGACTGGAGCAGG + Intergenic
1099228640 12:79997773-79997795 CAGTATTATAAGATTGGAGATGG - Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100356518 12:93836161-93836183 TAATTTCAGCAGAGTGGAGATGG - Intronic
1100734265 12:97509622-97509644 CAGTATGAGAGGGGAGGAGAAGG - Intergenic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1104908134 12:132226298-132226320 CAGTATGTGCAGCGTGTATATGG - Intronic
1104913008 12:132248948-132248970 CAGGATCTGCAGAGTGGAGCGGG + Intronic
1107236753 13:38179564-38179586 CAGTATGAGGATAGTAGTGAAGG - Intergenic
1107743126 13:43475297-43475319 CAGCCTAAGCAGTGTGGAGATGG + Intronic
1108109680 13:47055487-47055509 CTTTATTAGCAGAGTGGAAATGG - Intergenic
1108581787 13:51834122-51834144 CAGTTTGTGCAGAGAAGAGAGGG + Intergenic
1108886599 13:55192859-55192881 TAAAGTGAGCAGAGTGGAGAGGG - Intergenic
1109230724 13:59753976-59753998 CAGTAGGAGGAGGCTGGAGATGG - Intronic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1110757226 13:79189608-79189630 CAATATAAGGAGAGAGGAGATGG - Intergenic
1110966432 13:81704065-81704087 CAGGATGTGAAGAGTGGAGGAGG + Intergenic
1111407802 13:87832636-87832658 CAGCATGAGAAGGGAGGAGAAGG - Intergenic
1112192251 13:97189192-97189214 AAGTATAAGAAGTGTGGAGATGG - Intergenic
1113095052 13:106654346-106654368 CTGTCAGAGCAGAGTGGGGAGGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1115087920 14:29539336-29539358 CAGGATCAGCAGAGTGGATCTGG + Intergenic
1117575440 14:57092635-57092657 CAGTGTGATCACTGTGGAGATGG + Intergenic
1117841267 14:59862848-59862870 AAGTTTGAGAAGAGGGGAGAAGG - Intronic
1118970960 14:70637336-70637358 CAGAATGGGGAGAGTGGGGAGGG - Intergenic
1119899596 14:78248637-78248659 CAGCATGTGCACTGTGGAGAGGG - Intronic
1120388359 14:83874009-83874031 CAGAAGGAGCAGACGGGAGAAGG + Intergenic
1121209830 14:92199898-92199920 CAAGAAGAGCAGAGAGGAGAGGG + Intergenic
1121888828 14:97570518-97570540 CAGGATGAGAAAAGGGGAGAAGG + Intergenic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1125394143 15:39228314-39228336 CAGGAAGAGAACAGTGGAGAAGG + Intergenic
1127300709 15:57650983-57651005 AATTATGAGCAGAGTGATGAAGG - Intronic
1129968450 15:79757190-79757212 CAGAAGGAGCAGGGTTGAGAGGG + Intergenic
1130162213 15:81413439-81413461 CAGCATAAGCTGAGGGGAGATGG - Intergenic
1130241206 15:82193897-82193919 CAGAATGAGGAGAGTGAAGGCGG - Intronic
1130338613 15:82979482-82979504 CTCTACTAGCAGAGTGGAGAAGG + Intronic
1130459222 15:84147262-84147284 CAGAATGAGGAGAGTGAAGGCGG + Intergenic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1131172362 15:90187556-90187578 GAATCTGAGCAGAGTGCAGAGGG + Intronic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1132696943 16:1206250-1206272 GAGCATGAGCAGCGTGCAGAAGG - Exonic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1137509880 16:49089930-49089952 GAGGAAGAGCAGAGAGGAGATGG - Intergenic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138217177 16:55214553-55214575 GAGGATGAGGAGAGGGGAGAGGG + Intergenic
1138284024 16:55794269-55794291 CAGGATGAGCAGAGTCCAGAGGG + Intergenic
1138284978 16:55802718-55802740 CAGGATGAGCAGAGTCCAGAGGG - Intergenic
1139524713 16:67507804-67507826 GACATTGAGCAGAGTGGAGAAGG - Intergenic
1139656311 16:68389174-68389196 CAGTAGGAGCAGAGCAGGGAGGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141157417 16:81606951-81606973 CAGTGTGAGGAGTGTGGAAAGGG + Intronic
1142296912 16:89230211-89230233 AAGGAGGGGCAGAGTGGAGAGGG + Exonic
1143301408 17:5913282-5913304 CATTTGGAGCAGTGTGGAGAGGG + Intronic
1143377301 17:6474344-6474366 CAGAATGAGGAGAGTGAAGTCGG - Intronic
1145187347 17:20806386-20806408 CTCTGAGAGCAGAGTGGAGATGG + Intergenic
1148103506 17:45107088-45107110 CTGTATGAGCGGAGAGGTGACGG - Exonic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155669733 18:28355811-28355833 CACTCAGAGCACAGTGGAGACGG - Intergenic
1155724433 18:29062004-29062026 CAGAAAGAGAAGAGTGAAGAAGG - Intergenic
1156124244 18:33883610-33883632 CAATGTGGGCAGATTGGAGATGG + Intronic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1157376505 18:47172137-47172159 CACTATGAAGAGAGTGGAGGAGG - Intronic
1158326558 18:56319620-56319642 ACATCTGAGCAGAGTGGAGAAGG + Intergenic
1158483795 18:57846509-57846531 CATTCAGAGCAGAGAGGAGAGGG + Intergenic
1160729621 19:635208-635230 CAATTTGAGCAGAGTGGGGCTGG + Intergenic
1161498614 19:4600784-4600806 CACTACAAGCAGAGGGGAGAAGG + Intergenic
1163585595 19:18161840-18161862 CAGTATGTGCAGGGCGGAGGAGG - Intronic
1166345033 19:42160200-42160222 CTGGGTGGGCAGAGTGGAGAAGG + Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166487414 19:43225288-43225310 CAGTGTGAGCAGAAAGGAAATGG + Intronic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1166745657 19:45140764-45140786 CAATATGACCAGAGTGGATGTGG + Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167698185 19:51026985-51027007 CAGAGAGAGAAGAGTGGAGATGG - Intronic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1168339983 19:55617145-55617167 GAGTATGAGCAGAGTTGGGAGGG + Exonic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925897340 2:8482811-8482833 GACTGTGAGGAGAGTGGAGAGGG + Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
927527223 2:23756132-23756154 CAGCATGGGAAAAGTGGAGAAGG - Intronic
928129971 2:28642337-28642359 CACTGAGAGGAGAGTGGAGAGGG + Intronic
928400997 2:30978722-30978744 CAGTATCAGCTGAGTGAATAGGG - Intronic
928992988 2:37255439-37255461 CAGTATCAGCAGACTAAAGAGGG + Intronic
931632407 2:64312786-64312808 ACGTAGGAGCTGAGTGGAGAAGG - Intergenic
932579103 2:72982081-72982103 CAGGAGGAACAGAGTGGAGCTGG + Intronic
932815191 2:74855748-74855770 CAGTATAGGTAGAGTGGAGGGGG + Intronic
935789302 2:106576272-106576294 CGGTAAGAACAGAGAGGAGAAGG + Intergenic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
936717352 2:115203464-115203486 CAGCATGAACAGATTGGAGAGGG + Intronic
938048537 2:128145815-128145837 TACTATGAGCAGACTGGAGTTGG + Exonic
940673291 2:156697048-156697070 CAGTATGAACTGAGTGGTGTTGG + Intergenic
941602602 2:167561295-167561317 CAGTCAGAGCAGTGTGTAGACGG + Intergenic
944436483 2:199695767-199695789 CAGCCTGTGCAGAGTGCAGAAGG + Intergenic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944502603 2:200377603-200377625 CATTTGGGGCAGAGTGGAGAGGG - Intronic
944634106 2:201657832-201657854 GAGCATGAGCAGGGTGAAGAAGG - Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
948620637 2:239232354-239232376 CAGTTTGAGGACAGAGGAGAAGG - Intronic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948742426 2:240056668-240056690 CAGGAAGAGCAGAGAGGAGGAGG + Intergenic
1170419037 20:16174115-16174137 TTGAATGAGCAGCGTGGAGAAGG - Intergenic
1170448176 20:16452157-16452179 GAGAATGAACAGGGTGGAGAAGG + Intronic
1170815708 20:19712468-19712490 CAGGATGGGCAGAGTAGAGGTGG + Intronic
1171461572 20:25300935-25300957 CAGTGTGAGGACTGTGGAGAAGG - Intronic
1173326516 20:42038479-42038501 AAGGATGAGCAGAGTGGACTAGG + Intergenic
1174921482 20:54707143-54707165 CAACATGAGCAGAGGAGAGAAGG + Intergenic
1175709469 20:61207537-61207559 CAGGAAGAGGAAAGTGGAGATGG + Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1177334554 21:19706911-19706933 CACTATGAGCAGTGTGAAAATGG + Intergenic
1177522614 21:22247529-22247551 CATTATTAGCAGAGTGAAAATGG + Intergenic
1178782988 21:35623870-35623892 CAGGATGACCACAGTGGAGGGGG - Intronic
1179877782 21:44279947-44279969 CAGCATGACCAGACTGGAGAGGG + Intergenic
1180012193 21:45058566-45058588 CAGTGGGGGCAGAGTGGGGAGGG + Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1182492294 22:30681389-30681411 CTGGATGAGCAGACTGGATAAGG - Intergenic
1183072902 22:35408655-35408677 CAGGGTGAGTAGGGTGGAGAAGG + Intronic
1183697637 22:39432193-39432215 CACTCTCAGCAGAGTGGAGTTGG - Intronic
1184027711 22:41870267-41870289 CAGCAGGAGCAGAGCAGAGATGG - Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
953208710 3:40855200-40855222 GAATGTGAGCAGAGTGGACAGGG + Intergenic
953684932 3:45069837-45069859 TAATTTTAGCAGAGTGGAGATGG + Intergenic
953695144 3:45152424-45152446 GAGTATGTGCACAGTGGAGGAGG - Intergenic
954044039 3:47914255-47914277 CACTATGAAAACAGTGGAGAAGG + Intronic
954143784 3:48623974-48623996 CAGCATGAGCTGAGGTGAGAGGG - Intergenic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
956508216 3:69965212-69965234 CAGTATGAGCATGGAAGAGACGG + Exonic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
961052016 3:123755061-123755083 CTGTATGAGCAGAGTCCTGAGGG - Intronic
962702893 3:138016507-138016529 AAAAATGAGCAGAGTGGAGAGGG + Intronic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
965007515 3:163044382-163044404 CTGGATGGGCAGAGTGGAAAAGG + Intergenic
965821125 3:172685306-172685328 CATTATGAGCCCAGTGAAGATGG - Intronic
965910221 3:173765808-173765830 CAAAATGAGCAGAATGGAAATGG - Intronic
966476631 3:180356108-180356130 AAGTATGAGAAGAGCGGGGAAGG + Intergenic
967216091 3:187211813-187211835 CAGTAGGACCAGAGTGGTAACGG + Intergenic
968203513 3:196777969-196777991 CGGTATGAAGACAGTGGAGATGG - Intronic
969711383 4:8846282-8846304 CAGCCTGTGCAGTGTGGAGAGGG - Intronic
970448968 4:16148386-16148408 CAGGATGAGAAGAGTGGCTAGGG - Intergenic
974272511 4:59669327-59669349 AAGTGGGAGCAGAGTGGAAAAGG + Intergenic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
975832793 4:78387587-78387609 CATCATGAGCATAGTGGAGAAGG - Exonic
976195373 4:82526993-82527015 CAGTATGATCTGGGTGGTGAGGG - Intronic
978705052 4:111698350-111698372 GAGTATGTGCATAGTGGAGCAGG + Intergenic
980312394 4:131148406-131148428 CAATATGAGCAGAGTAGATTGGG + Intergenic
980467371 4:133203332-133203354 AACTATGAGCAGAGTATAGAGGG - Intronic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
984124359 4:175788021-175788043 AAGGATGAGAAGAGTGTAGATGG - Intronic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
987723375 5:21665751-21665773 CAGAATGAGATGGGTGGAGAAGG + Intergenic
989094817 5:37772027-37772049 CAGAATGGGCTGAATGGAGAAGG - Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989181008 5:38577170-38577192 CAGGATGAGAAGAAAGGAGAGGG - Intronic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
991122231 5:63029869-63029891 CAGTAAGGGCAAAATGGAGAGGG + Intergenic
991540419 5:67721419-67721441 TAGTTTGAACACAGTGGAGATGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993875360 5:93300131-93300153 CAGTATGGGCAAAGTGGATTTGG + Intergenic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994840628 5:104920799-104920821 TTGTTTTAGCAGAGTGGAGAGGG - Intergenic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
995359134 5:111274051-111274073 CAGTGTGAGCAGAAAGGAGTGGG - Intronic
995397798 5:111706438-111706460 CAGTTTGTCCAGGGTGGAGATGG + Intronic
996432737 5:123399904-123399926 TAGTATGAGGAGACTGAAGAGGG + Intronic
997109771 5:131062127-131062149 TAGTATCAGCAGAGTAGAAAGGG + Intergenic
997231831 5:132251158-132251180 CAGGATCAGCAGTGTGGAGTTGG - Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
997715689 5:136040944-136040966 GAGTATAAGGAGAGTGGAGCAGG + Intronic
997737993 5:136228557-136228579 CGGGATGAGCAGAATGGAGCAGG + Intronic
997991887 5:138551386-138551408 CTGTGTGAGCTGAGTGGGGAAGG + Intergenic
998269598 5:140694693-140694715 CAGCAGGAGCTGAGTAGAGATGG - Intronic
998380049 5:141717852-141717874 CAGTATGGCCAGGGTGGTGATGG + Intergenic
999242411 5:150135658-150135680 CAGTGTGAGCACGCTGGAGAAGG + Exonic
999976842 5:156920521-156920543 CAGTGTGAGCAGAGTGGCTGCGG + Intronic
1000064253 5:157681554-157681576 CTGGATGAGCAGACTGGATAAGG - Intergenic
1001539902 5:172530523-172530545 CTGTATGTGCAGAGTGCTGAAGG + Intergenic
1003093488 6:3123703-3123725 CATTACCAGCAGACTGGAGAGGG + Exonic
1005726770 6:28656928-28656950 CATTAGGAGCAGAGTGGGGACGG + Intergenic
1006442175 6:34059574-34059596 CAGCATGTGCAGAGGGGTGAGGG - Intronic
1007230600 6:40345217-40345239 CTTTATAAGCAGAGTGGACATGG + Intergenic
1007449457 6:41931897-41931919 GGGAATGGGCAGAGTGGAGAAGG + Intronic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009994423 6:70882582-70882604 CAGTATTAACAGAGTGGGAAAGG + Intronic
1010743185 6:79531234-79531256 CAGTTTTAGCAGAGTTGAGAGGG - Intronic
1011253174 6:85394328-85394350 CAGTAGAAGCAGAGAGGAAATGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1014964309 6:127728025-127728047 CATTCTGAGCAAAATGGAGAGGG - Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1017584376 6:155904187-155904209 CTGCATGAGCATGGTGGAGAAGG + Intergenic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1021198450 7:17698578-17698600 CCCTAGGAGCAGTGTGGAGAAGG + Intergenic
1021414106 7:20362132-20362154 TAGTAGGAGAAGAGTAGAGAGGG - Intronic
1022438234 7:30410402-30410424 CAGTCTGAGTAGAGTGGTCAGGG - Intronic
1022715646 7:32895540-32895562 TAGTATGAGCAGAAAGGAAAAGG + Intergenic
1025724241 7:64043168-64043190 CAGTATGAAGGGAGTGGGGAGGG - Intronic
1025753341 7:64312140-64312162 CAGTATGAAGAGTGTGGGGAGGG + Intronic
1026797458 7:73375626-73375648 CTGAATCAGCAGAGAGGAGAAGG + Intergenic
1028130383 7:87164938-87164960 GAGTATGAGCACAGTGGAAGAGG + Exonic
1028593996 7:92528555-92528577 CAGGATGCGCAGCGGGGAGAGGG - Intergenic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1031418771 7:121524363-121524385 GAGAATGAGAAGAGTAGAGAAGG - Intergenic
1031748070 7:125530566-125530588 GAATATGAGGAGAGTGGAAAAGG + Intergenic
1032254343 7:130285084-130285106 CAGTTTCAGAAGAGTGGATAAGG + Intronic
1033530924 7:142263311-142263333 AAGTTTGAGGAGAGAGGAGAGGG + Intergenic
1033537884 7:142328802-142328824 CTTTATGTGCAGAGAGGAGACGG - Intergenic
1033551401 7:142451464-142451486 CTTTATGTGCAGAGAGGAGACGG - Intergenic
1033553666 7:142470029-142470051 CTTTATGTGCAGAGAGGAGATGG - Intergenic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1034823042 7:154234781-154234803 CAGTATGGGCTGGGTGGAGATGG + Intronic
1035329457 7:158086664-158086686 CAGTATGAGCTGAAACGAGAAGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036521363 8:9494493-9494515 CAGTAAGAGCAGAAAGTAGATGG - Intergenic
1037554427 8:20008427-20008449 AAGTATGAGCAGGGTGGTGGTGG + Intergenic
1038952156 8:32427337-32427359 CAGAAAGAGCCAAGTGGAGATGG - Intronic
1039254968 8:35709106-35709128 GGGTTTGAGCAGAGTGGAGATGG - Intronic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1042469724 8:69171881-69171903 CAGTAAAAGCAGTGTGAAGAGGG - Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1044108437 8:88240444-88240466 CAGCAAGGACAGAGTGGAGAGGG + Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1046058479 8:109107489-109107511 CAGTATTAGTATAGTGGTGAAGG - Intronic
1048531580 8:135254850-135254872 CAGAAGCAGCAGAGAGGAGAAGG + Intergenic
1049140534 8:140950110-140950132 GAGGATGAGCAAGGTGGAGAGGG - Intronic
1050577434 9:7011848-7011870 CGGCATGAGCAGAGTGCAGATGG - Exonic
1050691662 9:8234321-8234343 GAGTGTGGGGAGAGTGGAGATGG - Intergenic
1050807403 9:9698456-9698478 CAGTATGAGAAGACTGGGTAGGG + Intronic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1055356997 9:75447947-75447969 CAGTAGCAGCAGAGAAGAGAAGG - Intergenic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1058611447 9:106780535-106780557 GAGTATAAGGAGAGTGGATAAGG + Intergenic
1060619382 9:125049821-125049843 CATTATGAGCAGAGTGAAAAAGG - Intronic
1060999454 9:127894851-127894873 CAGTATGATCAGTGTTGTGATGG - Intronic
1061641802 9:131964043-131964065 GATTGTGAGGAGAGTGGAGAAGG + Intronic
1186536933 X:10359685-10359707 AAGGATGAGGAGAGTAGAGAGGG + Intergenic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187485886 X:19703043-19703065 CAGTGTGGGCATAGTGGAGTTGG - Intronic
1187766437 X:22647723-22647745 AGGTTTGAGGAGAGTGGAGAAGG + Intergenic
1188092056 X:25976627-25976649 CAGGAAGAGCAGTGTGGTGAGGG + Intergenic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189414363 X:40801774-40801796 CAGTTGGAGCACAGAGGAGAAGG + Intergenic
1189618803 X:42813825-42813847 CAGTTAGAGCAGTGTGTAGAGGG - Intergenic
1189924403 X:45937690-45937712 CAGCATGGGCAGAGTAGATATGG - Intergenic
1190462477 X:50692126-50692148 CAGTATGAGGAAAGAGGACATGG + Intronic
1191985346 X:66973986-66974008 CATTTAAAGCAGAGTGGAGAGGG + Intergenic
1192097469 X:68227745-68227767 CAGTTAGAGCAGTGTGTAGAGGG + Intronic
1194138908 X:90182966-90182988 CATTCTGAGCAGATTGGAAAGGG - Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1197828319 X:130614463-130614485 CAGAAGGAGCAGATTTGAGAAGG - Intergenic
1198212739 X:134530551-134530573 GAGTCTGAGCAGGGAGGAGAGGG - Intergenic
1200122479 X:153797683-153797705 GAGTGTGGGCAGAGTGGACACGG - Intronic
1200484710 Y:3753199-3753221 CATTCTGAGCAGATTGGAAAGGG - Intergenic
1201965902 Y:19735449-19735471 AAGGATGAGCAAAGTGGAGGTGG - Exonic