ID: 959557175

View in Genome Browser
Species Human (GRCh38)
Location 3:107733894-107733916
Sequence CTACAAATGCAGACTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959557175_959557179 11 Left 959557175 3:107733894-107733916 CCATGCACAGTCTGCATTTGTAG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 959557179 3:107733928-107733950 TTCCCAGAGACATTTAACAGAGG 0: 1
1: 0
2: 1
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959557175 Original CRISPR CTACAAATGCAGACTGTGCA TGG (reversed) Intronic
900113028 1:1016964-1016986 CTATAAATACAGACAGGGCACGG - Intergenic
901260233 1:7865645-7865667 CTCCAAATACAGGCTGAGCATGG + Intergenic
903147114 1:21381494-21381516 TTCCCAATGCAGACTTTGCAGGG + Intergenic
903259735 1:22124941-22124963 CTGGAAAGGCAGACTGGGCAGGG - Intronic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904062111 1:27719799-27719821 ATATAAATCCAGACTGGGCATGG + Intergenic
904431715 1:30468658-30468680 CTCCCAATGCAGTCTGTGCAGGG + Intergenic
908890187 1:68837693-68837715 CTACAAAGGCAGATTGAGCTTGG - Intergenic
909194937 1:72607375-72607397 CTACAAGAGAAGACTTTGCAGGG - Intergenic
910160936 1:84271479-84271501 CTACAAATTCAGAGTATACAGGG + Intergenic
910698899 1:90050799-90050821 CTACAAATGCACACCTTACAAGG - Intergenic
910846236 1:91606909-91606931 CAACATACGCAAACTGTGCATGG - Intergenic
911076659 1:93882156-93882178 CTAAAAATGCATACTATTCATGG + Intergenic
912000219 1:104823729-104823751 CTGCAAATGCAGACTGATAAAGG - Intergenic
912634391 1:111278492-111278514 ATACAAATGCCTACTTTGCATGG - Intergenic
913224634 1:116687965-116687987 AAACAAATGCAGGCTGGGCACGG + Intergenic
915889121 1:159754752-159754774 ATAAAAATACAGACTTTGCAGGG + Intergenic
916767860 1:167879129-167879151 CTCTGAAGGCAGACTGTGCAGGG + Intronic
917862545 1:179161022-179161044 TTAGAAATGCAGGCTGGGCATGG - Intronic
919737448 1:200961771-200961793 CTACAAATGCAGAATGTTATAGG + Intergenic
921387359 1:214583907-214583929 CTACGAACACAGACTGTGCATGG + Intergenic
921666401 1:217877528-217877550 ATACATATGCAGGATGTGCAGGG - Intergenic
922517036 1:226215283-226215305 GTACAAATGCAGAATGTGCCAGG - Intergenic
1063197389 10:3756329-3756351 CTACAATTGCTGCCTGTGCCCGG + Intergenic
1068204817 10:53836304-53836326 TTACACATGCAGGCTGTACAAGG + Intronic
1077223227 11:1426527-1426549 CCGCAAATGTAGAGTGTGCAGGG + Intronic
1078279151 11:9882255-9882277 GTACAAATGCAGAGTTTTCAAGG - Intronic
1078377275 11:10807043-10807065 CTACAAATGAAGACTGAACTCGG + Intronic
1081857595 11:46313394-46313416 TTAGAAATGCAGGCTGGGCACGG + Intronic
1082690456 11:56296643-56296665 ATACAAATGCCAACTGTGCGTGG + Intergenic
1085356105 11:75838641-75838663 TTACAAATGCAGGCTGGGTACGG - Intronic
1088786974 11:113190950-113190972 TTTCAAATGCACACTCTGCAGGG + Intronic
1089315853 11:117590789-117590811 CCTCAAATGCAGACTGAGAATGG + Intronic
1091345998 11:134854602-134854624 CTCCATGTGCAGAATGTGCAGGG + Intergenic
1092512902 12:9176420-9176442 GTACAAGTGCAGAATGTGAAGGG - Intronic
1093872525 12:24308665-24308687 CAACAAATGCAGACTGACTATGG + Intergenic
1094341686 12:29419146-29419168 TTAGAAATGTAGACTGGGCATGG - Intronic
1099204216 12:79710127-79710149 TTACAACTGCAGGCTGTGCGCGG - Intergenic
1100207446 12:92366105-92366127 TTACAAATGTAGACTGTGGCAGG + Intergenic
1101141323 12:101798569-101798591 ATACAAACACAGACTGTACATGG + Intronic
1103569192 12:121833068-121833090 CTACAAGTTCAGGCTGGGCACGG - Intergenic
1112380581 13:98885311-98885333 GTACATATGCAGGCTGGGCATGG + Intronic
1112986593 13:105457339-105457361 CTACAATTGGAGACCGGGCACGG - Intergenic
1115887136 14:37985025-37985047 CTACAAATTCTGAGTGTGCCTGG + Intronic
1123431522 15:20221276-20221298 CTACAAATGCAGACTGGTACTGG - Intergenic
1124649016 15:31461400-31461422 CTTGGAATGCAGACTGTACAGGG - Intergenic
1129503809 15:76064214-76064236 CTAATAATGCAGGCAGTGCAAGG - Intronic
1129944365 15:79526182-79526204 CTAAAAATGCAGCCTTTGCCCGG - Intergenic
1131736504 15:95338382-95338404 CATCAAATACAGACTGGGCACGG - Intergenic
1132982768 16:2747229-2747251 TTAAAAATGCAGGCTGGGCACGG - Intergenic
1133858613 16:9573318-9573340 CTGCAAATGCAAAGTGTGGATGG + Intergenic
1133883992 16:9809127-9809149 ATACAAATGCAGACCGGGCACGG + Intronic
1134250895 16:12573032-12573054 CTACAACTGCAGAATTAGCACGG - Exonic
1136853130 16:33629952-33629974 CTACAAATGCAGACTGATACTGG + Intergenic
1139377798 16:66511316-66511338 CTAGAAATGCTGACTGTCCTTGG + Exonic
1140266326 16:73424423-73424445 GTACATATGCAGAAGGTGCAAGG - Intergenic
1140280872 16:73554540-73554562 CTACAGATTCAGACTTTTCAGGG + Intergenic
1140329384 16:74038923-74038945 CTTCAAATTCAGGCTGTGCAGGG + Intergenic
1141402028 16:83757285-83757307 CAACAAATCCAGGCTGGGCACGG + Intronic
1141505808 16:84477619-84477641 CTACAAATGAAGACTTATCAGGG - Exonic
1141917278 16:87107991-87108013 CCACCAATGCAGCCTGTGCAAGG + Intronic
1203114723 16_KI270728v1_random:1478374-1478396 CTACAAATGCAGACTGATACTGG + Intergenic
1143442149 17:6983297-6983319 CTACAAATACTGACTGTGGGAGG + Intronic
1143737129 17:8919637-8919659 ACACAAATGCAAACTGGGCACGG - Intronic
1150496932 17:65615127-65615149 TTACAAATACCAACTGTGCAAGG + Intronic
1150753294 17:67886536-67886558 CTACAAAAGCACACAGAGCAGGG + Intronic
1151136946 17:71956085-71956107 CTAAAAATGCAAACAGTGCCAGG + Intergenic
1154260891 18:12831732-12831754 CTACAAATGCACAGTATGTACGG + Intronic
1156533236 18:37838295-37838317 CTAAAAATGCTGACTTTCCATGG + Intergenic
1156581591 18:38382916-38382938 CCACAGATGGAGACTATGCATGG - Intergenic
1156920775 18:42520181-42520203 CTACAAAAACACACTGTGCTTGG + Intergenic
1159756135 18:72368722-72368744 CTACATATGCACACAGTGCTGGG - Intergenic
1159909771 18:74134713-74134735 CTAGAAATGCAGACTAGGGATGG + Intronic
1160081411 18:75730999-75731021 AAAGAAATGCAGACTGTGCTTGG + Intergenic
1160103294 18:75944786-75944808 ATAAAAATGCAGGCTGGGCATGG + Intergenic
1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG + Intergenic
1165645381 19:37431521-37431543 CTACCACTGCTGACTGTTCAGGG - Intronic
1167161484 19:47770261-47770283 ATACAAATGCATACGGTGCGAGG - Intergenic
1168396021 19:56049469-56049491 CTAAAAATACAGGCTGGGCACGG - Intronic
1168691442 19:58380018-58380040 CAACAAAAACAGAATGTGCAGGG + Intronic
930856730 2:56026918-56026940 CAATACACGCAGACTGTGCAAGG - Intergenic
930874491 2:56199255-56199277 ATACAAATACAGAATGTGTAGGG + Intronic
932308754 2:70723114-70723136 CTACAAATCCAGGCTCTGAATGG + Intronic
936929461 2:117772637-117772659 CTACAAATCAAGACTTTGTAAGG + Intergenic
942969739 2:181943554-181943576 CTCCAAATGCATACTGAACAGGG - Intergenic
943616372 2:190097092-190097114 GTACATGTGCAGAATGTGCAGGG + Intronic
946038452 2:216763620-216763642 CTGCAAATGCAGGCAGTGGATGG - Intergenic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
946894890 2:224313367-224313389 CTACTAATGGAGATTGTGAAGGG - Intergenic
947718427 2:232353109-232353131 CAATAAAGGCAGTCTGTGCAGGG - Intergenic
1169126071 20:3127604-3127626 CTACAAATGCAGACTGACCGAGG - Intronic
1170061951 20:12268543-12268565 CTACAAATTCAGTATGTGCCAGG + Intergenic
1172138976 20:32708445-32708467 CTCCAAAATCAGACTGAGCAAGG + Intronic
1172578490 20:36028281-36028303 CCGCAAATGCTGACTGAGCAGGG - Intronic
1174620849 20:51873508-51873530 CTAAAAATACAGGCTGGGCACGG - Intergenic
1175453334 20:59089526-59089548 CTACAAAGTCAGATTGTCCAAGG - Intergenic
1176229953 20:64027454-64027476 CCACAAATGCAGAGTGTGAGGGG + Intronic
1176641137 21:9304852-9304874 CTAAAAATGCAAAATGTGCTGGG + Intergenic
1177414130 21:20772350-20772372 AGACACATGCAGAATGTGCAGGG - Intergenic
1179071322 21:38073745-38073767 CTACTAATGCAGACTTACCAAGG - Intronic
1180388053 22:12198018-12198040 CTAAAAATGCAAAATGTGCTGGG - Intergenic
1181958437 22:26605232-26605254 CTACAATTGCAAACTGTGGTAGG - Intronic
1182123296 22:27800275-27800297 CTGCAAGCGCAGCCTGTGCACGG - Exonic
1182790912 22:32951996-32952018 CTAAAAATACAGCCTGTGCCGGG - Intronic
949680204 3:6504901-6504923 CTGCAAATGAAGACTGAGCCAGG - Intergenic
950098235 3:10342482-10342504 CAACAAGTACAGACCGTGCAAGG - Intronic
950380231 3:12606984-12607006 CTAGAAATGCACACTGGGCCGGG - Intronic
950574385 3:13823025-13823047 CTCAAAATGCAGAGTGTGCAGGG - Intronic
954607385 3:51923434-51923456 CTACATAAGCAGGCTGGGCACGG + Intergenic
954772052 3:52980146-52980168 ATACAAACACAGACTGTACATGG + Intronic
955028881 3:55197395-55197417 CTACAAATGAAGTCTGTGACAGG + Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957580914 3:82072147-82072169 CTAAATATGCAGACAGTACAAGG - Intergenic
958143449 3:89592785-89592807 CTATAAATGCAGTTTGTGTATGG + Intergenic
959557175 3:107733894-107733916 CTACAAATGCAGACTGTGCATGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961165429 3:124760239-124760261 CTGGAAATGCAGACAGGGCATGG - Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
966285453 3:178289826-178289848 CGACAACTGAAAACTGTGCATGG - Intergenic
966296310 3:178427652-178427674 CTGCCCATGCATACTGTGCAGGG - Intronic
967192325 3:186995548-186995570 GTTAAAATGCAGGCTGTGCATGG + Intronic
1202745757 3_GL000221v1_random:100174-100196 CTAAAAATGCAAAATGTGCTGGG - Intergenic
969708528 4:8829615-8829637 CAAAAAATGCACACTGTGAAGGG + Intergenic
971732444 4:30402851-30402873 ACATAAATGCAGACTGTACATGG + Intergenic
978770444 4:112451162-112451184 TTAAAAATCCAGACTGTGAAAGG + Intergenic
978821287 4:112969490-112969512 CTACAAGTTCAGACTCTCCAGGG + Intronic
979134900 4:117098560-117098582 CTATAAATCCAGACTGTGGATGG + Intergenic
982285852 4:153733678-153733700 GGAGAAATGCAGACTGTGCAAGG - Intronic
982874825 4:160633942-160633964 ATACAAATAAAGACTGTACATGG + Intergenic
985966154 5:3340096-3340118 GTACAAAAGCAGAGGGTGCACGG - Intergenic
986114836 5:4762831-4762853 TAAAAAATACAGACTGTGCAAGG - Intergenic
986532025 5:8747472-8747494 CTGTTAAAGCAGACTGTGCAGGG - Intergenic
987500810 5:18707497-18707519 GTACATGTGCAGAATGTGCAGGG + Intergenic
988778529 5:34498604-34498626 CCAGAAATGAAGACTGTGCTCGG + Intergenic
992229824 5:74653162-74653184 CTACAAATGCAGACTGAAACTGG + Intronic
993548263 5:89240535-89240557 ATACAAATGGAGACTTTGCAAGG - Intergenic
993564663 5:89458310-89458332 ATATAAAAGCAGACTGGGCAAGG - Intergenic
993907382 5:93638520-93638542 ATAGAAATGCAGGCTGGGCACGG + Intronic
994817759 5:104606216-104606238 CTAAAAATGAAGACTAGGCATGG - Intergenic
995201564 5:109430427-109430449 CTAGAAATGCAGAAGGTGCCCGG + Intergenic
996066167 5:119081733-119081755 GGACAAATTGAGACTGTGCATGG + Intronic
996148886 5:120010746-120010768 AGAAAAATGCAGACTGGGCATGG - Intergenic
996819129 5:127606363-127606385 CTGCAAAGTCAGACTGTGGAGGG - Intergenic
997607353 5:135184771-135184793 CAACAAATGCCGACTGGGGACGG + Intronic
997867792 5:137480010-137480032 CCACAAGTCAAGACTGTGCAGGG + Intronic
999401350 5:151266779-151266801 CTGCCAATGTAGTCTGTGCATGG - Exonic
999949570 5:156634391-156634413 ATACATATGCAGGATGTGCAAGG - Intronic
1000322791 5:160148247-160148269 CTAAAAATACAGATTGGGCACGG - Intergenic
1001761829 5:174214024-174214046 CTACAACAGCGGGCTGTGCAAGG - Intronic
1001929592 5:175663575-175663597 GGAGAAATGCAGACAGTGCACGG - Intronic
1008300138 6:49827231-49827253 CTAAGAAAGCAGACTGTGTAAGG + Intergenic
1009459394 6:63894143-63894165 CTCCAAATGCACCCTGTGCCAGG - Intronic
1009571893 6:65395505-65395527 ATACAAATGATAACTGTGCAAGG - Intronic
1012202101 6:96419447-96419469 ATACAAATGGAGATTGTGCCTGG - Intergenic
1012814880 6:104010677-104010699 CAAGAAATGCAGGCAGTGCAAGG + Intergenic
1013996572 6:116315709-116315731 CTACAAATGCGGGCTGGGCACGG + Intronic
1015137515 6:129890562-129890584 CTCCAAATGCAGAGTGAGCAGGG + Intergenic
1016179903 6:141132791-141132813 TCACTAATGCAGACTGTGTAGGG + Intergenic
1016487369 6:144556249-144556271 CCACAAATGCAGACTTTACTTGG + Intronic
1016859832 6:148706381-148706403 CTTCATCTGCAGACTGTGCTGGG + Intergenic
1018256929 6:161929961-161929983 CTGAAAATGCAGTCTGTGCAAGG - Intronic
1021759886 7:23893395-23893417 CCACAAATGCAGAGTGCTCAGGG - Intergenic
1022281264 7:28912213-28912235 AGACAAATGCAGACAGGGCAGGG + Intergenic
1023047998 7:36228236-36228258 AAACAAATACAGACTGGGCATGG + Intronic
1023360780 7:39413293-39413315 GTAAAAATGCAGAACGTGCATGG - Intronic
1024204731 7:47147586-47147608 ATGCAAATGCAGACTGGGCTAGG + Intergenic
1025272481 7:57538052-57538074 GTACATATGCACAATGTGCAAGG + Intergenic
1025866618 7:65388346-65388368 CTACAAATGTAGGCTGGGCGTGG + Intronic
1026232776 7:68499795-68499817 CTCTCAATGCACACTGTGCATGG - Intergenic
1027372438 7:77520334-77520356 CTACAAATGCAGACTGATAGAGG + Intergenic
1028261230 7:88668856-88668878 AGACAAATGCAGTCTATGCAGGG + Intergenic
1031275651 7:119719495-119719517 TTACAAATGCAGACTGTAAATGG + Intergenic
1032810977 7:135417076-135417098 CTACAAATGCAGATTGTTACTGG - Intronic
1032885784 7:136136797-136136819 CGATAAATGCAGAGTGTACAGGG + Intergenic
1033681094 7:143597587-143597609 CTACAAATAAAGTCTGTGGAAGG - Intergenic
1033703798 7:143864226-143864248 CTACAAATAAAGTCTGTGGAAGG + Intronic
1034878830 7:154748631-154748653 CTCCAGAGGCAGGCTGTGCAGGG - Intronic
1036185723 8:6621051-6621073 CTGCAAATGCCGGCTGTGCTGGG - Intronic
1036919910 8:12842445-12842467 TTTAAAATGCAGACTGTGCCTGG + Intergenic
1037479920 8:19294960-19294982 CTACATATCCTGACAGTGCAGGG + Intergenic
1038865035 8:31430338-31430360 CCACTAAAGCAGAGTGTGCAAGG + Intergenic
1038965998 8:32573149-32573171 CTCAAAATGCAGACCCTGCATGG + Intronic
1039220764 8:35327694-35327716 CTACAACTGCAGACCGTGCCAGG - Intronic
1040907701 8:52485915-52485937 ATACAAATGCACAGTGAGCAAGG - Intergenic
1047349619 8:124061367-124061389 CTACAATGGAAGAATGTGCATGG + Intronic
1047707668 8:127516789-127516811 ATACAACTGCAGATTGAGCATGG - Intergenic
1048318159 8:133377201-133377223 CTGCAAAGTCAGGCTGTGCAAGG + Intergenic
1048341751 8:133545352-133545374 TTACAAAGGCAGACTGGGCCAGG + Intronic
1051656617 9:19388023-19388045 TTACAAATGCAGGCTGGGCATGG - Intergenic
1053242993 9:36511717-36511739 ATAGAAATGCAGGCTGGGCATGG - Intergenic
1054936064 9:70688944-70688966 CAACAAATGCTTACTGAGCAAGG - Intronic
1055556386 9:77478060-77478082 GTACATATGCATAATGTGCAGGG + Intronic
1057505294 9:95628328-95628350 CCACAAATGCTGCCTGAGCAAGG + Intergenic
1059067563 9:111101635-111101657 CTTCAAATGCAGGCCGGGCATGG - Intergenic
1203714378 Un_KI270742v1:130130-130152 CTAAAAATGCAAAATGTGCTGGG - Intergenic
1186207569 X:7216403-7216425 CAACAAATGCAGACTTAGTAAGG + Intergenic
1188761707 X:34040561-34040583 CTACAAATGCAGCCTGAGAGAGG - Intergenic
1190855418 X:54289617-54289639 CCACAAAGCCAGACTGTGCAAGG - Intronic
1192313920 X:70037406-70037428 CTACAACTGCGGACTGTCCGAGG - Exonic
1192810378 X:74542024-74542046 CTTCAAGTTCAGAATGTGCATGG - Intergenic
1194563761 X:95455720-95455742 CTTCAAATGAACACTGAGCAAGG + Intergenic
1195024557 X:100863244-100863266 CTACAAATGTAGAATGATCATGG + Intronic
1196619582 X:117806956-117806978 CTACAAATGCTGACTATTCAGGG - Intergenic
1197589847 X:128394809-128394831 CTACACATGCACCCTTTGCAAGG - Intergenic
1202045790 Y:20736228-20736250 CTCCAAATGCAGGCAGTACATGG + Intergenic