ID: 959557844

View in Genome Browser
Species Human (GRCh38)
Location 3:107742828-107742850
Sequence CTGTTTGCAAATCTTTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959557844_959557846 21 Left 959557844 3:107742828-107742850 CCATCCTAAAGATTTGCAAACAG 0: 1
1: 0
2: 0
3: 14
4: 222
Right 959557846 3:107742872-107742894 TCTGACTTGATGTGTTGTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959557844 Original CRISPR CTGTTTGCAAATCTTTAGGA TGG (reversed) Intronic
903762724 1:25710259-25710281 CTGTTTCCACATCTGTAAGATGG + Intronic
905947133 1:41912776-41912798 CTGTCAGCAAATCTTGATGAGGG - Intronic
906271817 1:44485215-44485237 CTGTTTGCATCTCTTCAGGCAGG - Intronic
907535405 1:55150746-55150768 CTGTTTGCTAAACTTTAAGAAGG - Intronic
907539866 1:55204968-55204990 CTGTTTGCACATTTTTAAGAAGG - Intronic
908797279 1:67843423-67843445 CTGGTTGAAAGTCTTTATGAGGG - Intergenic
909774964 1:79472491-79472513 CTGTTAGAAAATCTGTAGCAAGG + Intergenic
910684186 1:89899506-89899528 ATTTTTGCAGAGCTTTAGGATGG + Intronic
911262995 1:95709593-95709615 CTGTTTGCTTATTTTTAAGATGG + Intergenic
912100917 1:106203191-106203213 CTGTTTGGAAATCTAAAGCAAGG + Intergenic
913677726 1:121157604-121157626 CCATTAGCAAATATTTAGGAAGG - Intergenic
914029560 1:143945233-143945255 CCATTAGCAAATATTTAGGAAGG - Intronic
914159889 1:145122717-145122739 CCATTAGCAAATATTTAGGAAGG + Intergenic
914777594 1:150752209-150752231 CTGATTGCAAATCTCTATCAAGG - Intronic
916844649 1:168637409-168637431 CTATTTGCAGAAGTTTAGGAAGG + Intergenic
918558831 1:185839126-185839148 CTGCTTGCAAGTCCTTAGAAAGG - Intronic
918705278 1:187652955-187652977 ATGATTTCAAATATTTAGGAAGG - Intergenic
919081315 1:192869584-192869606 TTGTATCCAAATCCTTAGGATGG + Intergenic
920031895 1:203042539-203042561 CAGTTTGCAAAGCCTTGGGATGG + Intronic
920465031 1:206176114-206176136 CCATTAGCAAATATTTAGGAAGG - Intergenic
920843536 1:209574963-209574985 CTCTTTGCAATCCTTTAGGCTGG + Intergenic
921119598 1:212125273-212125295 CAGTTTCCTGATCTTTAGGATGG - Intergenic
921330868 1:214034028-214034050 CAGTGTGAAAGTCTTTAGGAGGG + Intronic
921645363 1:217609274-217609296 CTGCTTGTACATCTTTAGAATGG - Intronic
922064263 1:222121386-222121408 CTGTTTACAAGTCTGTAGGTGGG + Intergenic
922134458 1:222811196-222811218 ATATTTGCACATCATTAGGAAGG + Intergenic
924039711 1:239972425-239972447 CTGGATGCAAATCCTGAGGATGG + Intergenic
1064695483 10:17961041-17961063 CAGGTTGGGAATCTTTAGGAAGG + Intronic
1066296957 10:34062488-34062510 CTGGATGTAAATCTTTAAGAAGG - Intergenic
1067836482 10:49644691-49644713 CTTTTTGCAAATCCTGGGGAAGG - Intronic
1070415233 10:76183054-76183076 CAGTCTGCCCATCTTTAGGAAGG + Intronic
1071130390 10:82385745-82385767 TTGTTTACAAATATTTAGTAAGG + Intronic
1071461652 10:85902724-85902746 CTGTTTTCTTATCTGTAGGATGG + Intronic
1072300995 10:94061995-94062017 CAGTTTCCAAATCTTTAAAATGG + Intronic
1072523640 10:96252693-96252715 CAGTTTGCAAAACTGTAGAATGG + Intronic
1076002855 10:126926040-126926062 CAGTTTGCACATCTGTAGGGTGG + Intronic
1076127365 10:127985669-127985691 CTGTTTCCAACTTTTAAGGAAGG + Intronic
1079653192 11:22956782-22956804 CTGTTTGCAAGTTTTTAGAATGG - Intergenic
1080155018 11:29099671-29099693 CTATTTGCAAATATTTTAGAAGG - Intergenic
1080269055 11:30431401-30431423 CTGTTTCCCAATCTGTAAGATGG + Intronic
1081354245 11:42093561-42093583 CTGTTTTCTAATCTGTAAGATGG + Intergenic
1081711654 11:45220492-45220514 CGGTTTGCACATCTGTAAGATGG - Intronic
1082081303 11:48014335-48014357 CTGTTGGTAACTCTTTAAGAGGG + Intronic
1084131175 11:67136232-67136254 CTGTTTCCAAAACTTTAAAATGG - Intronic
1085525929 11:77163910-77163932 CTGCTTTCAATTCTTTTGGATGG + Intronic
1085786328 11:79454330-79454352 CTCTCTGCAAATTTTTAGGATGG + Intergenic
1086436124 11:86782583-86782605 CAGTTTGCAAAGGTTTAGTAAGG - Intergenic
1089051961 11:115553464-115553486 CTGTTTACAAATCTCTAGAGTGG + Intergenic
1089321667 11:117630621-117630643 CAGTTTCCAAATCTGTAAGACGG - Intronic
1089712637 11:120326792-120326814 CTCTTGGCAAATCTTTGGGTCGG + Intronic
1090074018 11:123568046-123568068 CTGGCTGCAAATGTTTTGGATGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090956148 11:131514474-131514496 ATGAATCCAAATCTTTAGGAAGG + Intronic
1093555642 12:20470521-20470543 CCATTTGCAAATTTTTATGAGGG - Intronic
1094709289 12:32945244-32945266 CTGTTTGGAAATCAATAGAACGG - Intergenic
1095825535 12:46526667-46526689 CTATTTGTCAATCTTTATGAAGG + Intergenic
1096000941 12:48129946-48129968 CAGTTTCCAAATCTTTAAAATGG + Intronic
1097516209 12:60610055-60610077 CAGTTTTCAAATCTGTAAGATGG - Intergenic
1099982563 12:89623633-89623655 ATGTTTGAAAATCATCAGGAAGG + Intronic
1100217781 12:92470303-92470325 CTTTTAGCAAGTCTTTTGGAAGG + Intergenic
1101084783 12:101225159-101225181 TTGGTTGCAAATCTGTATGAAGG + Intergenic
1101837442 12:108305254-108305276 CTATTTGCAAATCTATGGAACGG - Intronic
1102543118 12:113636532-113636554 CTGTTTGCACATCTATAAAATGG - Intergenic
1104374625 12:128253008-128253030 CTGTTTTCTAATCTTTAAAATGG - Intergenic
1106029701 13:25988862-25988884 CTATTTGCAATTCTTATGGAGGG + Intronic
1106197964 13:27510175-27510197 CTGTTTCTAAAGCTTCAGGATGG - Intergenic
1107597756 13:41980703-41980725 CTGTGGCCAAATCTTGAGGATGG - Intergenic
1110247134 13:73339597-73339619 CAGTTTCCAAATCTGTAAGATGG - Intergenic
1113025399 13:105935644-105935666 CTGAAAGCAAATCTTTAGCATGG + Intergenic
1114754447 14:25243983-25244005 CTGTTTACAAAGCTGTTGGAGGG - Intergenic
1115583927 14:34790695-34790717 CTGTTTGAAAATATTTAGCCTGG - Intronic
1117898465 14:60510403-60510425 CTGTTTTCAAAGCATTAGGGAGG - Intronic
1118068087 14:62214192-62214214 CTGTTTTCTCATCTTTATGATGG - Intergenic
1118113603 14:62750097-62750119 CTGTTTGCCAATCTTCACCAGGG + Intronic
1118581255 14:67300678-67300700 CTGTTTCCTTATCTTTAGAATGG - Intronic
1119586910 14:75844432-75844454 TTGTTAGAAAATCTTTAGCAGGG + Intronic
1120312128 14:82842444-82842466 TTGTGTGCATATCTTGAGGAAGG + Intergenic
1120478029 14:85013375-85013397 CTGATTTCAAATCCTTTGGATGG + Intergenic
1122536457 14:102467129-102467151 ATGTGTGCAAGTCTTTAGGGAGG + Intronic
1123800607 15:23815961-23815983 GTGTTTTTAAATCTTAAGGAAGG + Intergenic
1123895788 15:24828748-24828770 GTGTTTGAAAATATTTAGCAAGG + Intronic
1130097516 15:80867072-80867094 CGGTTTGCAAATCTGTAAAATGG + Intronic
1130200955 15:81826391-81826413 CTGTTTCCAAATCTGTAAAATGG - Intergenic
1131365881 15:91839110-91839132 CTGTTTGCTTATCTTTAAAATGG - Intergenic
1131683101 15:94744572-94744594 CTGTTTGAAAATATTTAGATGGG - Intergenic
1131709830 15:95041102-95041124 TTGATTGCATTTCTTTAGGAAGG - Intergenic
1132245410 15:100292664-100292686 CAGTTTGCACATCTGTAGAATGG - Intronic
1132294052 15:100722222-100722244 CTGTTTGCATTTCTTTGGCAAGG - Intergenic
1133328248 16:4955556-4955578 GTGTTTGTAAAGCTTTAGAATGG + Intronic
1141142948 16:81509234-81509256 CTGCTTGCGCATCTATAGGATGG - Intronic
1149305487 17:55342949-55342971 CTATTTGAAAATTTTTAGCAGGG + Intergenic
1149639511 17:58193703-58193725 CTGTTAGCACATCTGTGGGAAGG - Exonic
1154069009 18:11135899-11135921 CCATTTGCAAATCTTGAGTATGG + Intronic
1157312190 18:46560638-46560660 CTGTTTGCTAAGCTGCAGGATGG + Intronic
1158748754 18:60233462-60233484 CTGTTTTCAAACATTTAGGATGG - Intergenic
1159842909 18:73420571-73420593 CTGTTTGCCAGAGTTTAGGATGG + Intergenic
1164011802 19:21210090-21210112 GTTTTTGCAAATCTTCAGGAAGG + Intergenic
1166625866 19:44355633-44355655 CTGTTTGCTTATCTTTAAAATGG + Intronic
925424299 2:3735956-3735978 TTTTTTGCAAATCTTGTGGAGGG + Intronic
929766984 2:44853001-44853023 ATGTTTACCAATCTTTAGTATGG - Intergenic
932484745 2:72077391-72077413 TTGATTGCAAGTCTTTATGAGGG + Intergenic
933679009 2:85082236-85082258 GTGTTTTCAAATCCATAGGAGGG - Intergenic
935063109 2:99624914-99624936 CTGTTTGGAAATCGGTAGGGTGG - Intronic
935164409 2:100557491-100557513 GTGTGTGCAAAGCTTTGGGATGG - Intergenic
936102974 2:109599547-109599569 CTGTTTGCATATCCTCCGGAGGG + Intronic
936418413 2:112341192-112341214 CTGTTTGCCCATCTTTAAAATGG - Intergenic
937141029 2:119600310-119600332 TTCTTTTCAAATCTTTAGGATGG - Intronic
940521107 2:154749390-154749412 CAGTTTGCCAGTCCTTAGGATGG + Intronic
941645612 2:168037390-168037412 ATGTTTCCAAATTTTTAAGAGGG + Intronic
941689499 2:168484489-168484511 TTTTTTCCAAATCTTGAGGAGGG + Intronic
942386723 2:175450720-175450742 CTGTTTGCAAAGATTTAGATTGG + Intergenic
943807452 2:192139874-192139896 CTAATTGTAAATCTGTAGGAAGG + Intronic
945279669 2:208024226-208024248 CTGTTTCCTAATCTGTAGAATGG - Intronic
945450698 2:209991996-209992018 GTGTTTTCAAATGTTTGGGAGGG - Intronic
945877154 2:215290024-215290046 CTTTTTACTCATCTTTAGGAAGG + Intergenic
948314833 2:237019747-237019769 CAGTTTGCACATCTTTAAAATGG - Intergenic
1169680915 20:8212932-8212954 TTCTTTGCAAATCTGTATGAAGG + Intronic
1170462618 20:16591643-16591665 CTATTTTCAATTCTTTTGGAAGG + Intergenic
1172840632 20:37901212-37901234 CAGTTTCCATATCTTTATGATGG + Intergenic
1175233489 20:57491696-57491718 CTGTATGCAAATGTTTATAATGG + Intergenic
1176908011 21:14527660-14527682 CTGAAAGCAAATCTTTAGCATGG - Intronic
1178158675 21:29885429-29885451 TTTTTTGCAGATCTCTAGGAAGG - Intronic
1181494227 22:23278927-23278949 TTGTTTGCCAATGTTTATGAAGG - Intronic
950671427 3:14528340-14528362 CTGTATGCAAATGTTTATTATGG - Intronic
952665918 3:35904134-35904156 TGGTTTGCAAATCTATAGAATGG + Intergenic
953113041 3:39962152-39962174 CTGTTTGCCCATCTATAGGATGG + Intronic
953974422 3:47371476-47371498 GGGTTTGCAAATATTCAGGAAGG - Intergenic
954122383 3:48507007-48507029 CTGTTTACAGAGCTGTAGGAAGG - Intergenic
955733223 3:62009535-62009557 TTGATGGCAAATCATTAGGAAGG - Intronic
956310751 3:67876913-67876935 GTGTTTGCACATCTATAGCAAGG + Intergenic
957112825 3:75988073-75988095 CTTTTTGGAAATGTTTATGAAGG + Intronic
959340374 3:105121911-105121933 CTGGTTACACTTCTTTAGGAGGG + Intergenic
959505277 3:107150403-107150425 CTATTTGCAAAGTTTTAGAAAGG + Intergenic
959557844 3:107742828-107742850 CTGTTTGCAAATCTTTAGGATGG - Intronic
960943894 3:122952990-122953012 CTGTTTACAAAGGTGTAGGAAGG - Intronic
961374455 3:126454514-126454536 CTGTATGGAAATATTTGGGAAGG - Intronic
964004810 3:151814045-151814067 CTGTTTTCAAAGCTTTTGGGTGG + Exonic
964651423 3:159015691-159015713 TTGTTTGACTATCTTTAGGAGGG + Intronic
967451713 3:189631348-189631370 CTCTTTGCAAATATGTATGAAGG + Intergenic
968904701 4:3445865-3445887 CAGTTTCCAAATCTGTAGAATGG - Intronic
969318540 4:6396380-6396402 CTGTTTGCTCATCTTTATAATGG - Intronic
971599452 4:28573393-28573415 ATGTTTTAAAATCTTTAAGAGGG - Intergenic
975201097 4:71590555-71590577 CTGTTTTCAGATCTGTAGTAGGG + Intergenic
975286037 4:72621552-72621574 CTGTTTGTCAATTTTTAGGAAGG + Intergenic
976417860 4:84800056-84800078 CTATTTTCAAAACTTTAGGACGG + Intronic
976551210 4:86397493-86397515 ATGTTTGGAAATCTTTAAAATGG - Intronic
977730101 4:100340869-100340891 CTGTTTACAAAAGTGTAGGAAGG - Intergenic
980086224 4:128393042-128393064 CTGTTTCCAAATGTTTTGGGTGG + Intergenic
980134016 4:128843150-128843172 CAGTTTCCAAATCTGTAAGACGG + Intronic
980191046 4:129525556-129525578 CAGTTTGTTAATCCTTAGGAAGG - Intergenic
980709666 4:136548744-136548766 CTGCTTTAAAATCTTTAAGATGG - Intergenic
983853731 4:172616122-172616144 ATGTTTCCAGATCTTTATGAAGG - Intronic
984350359 4:178582871-178582893 CTGGTTGAAAATTTTTAGAATGG - Intergenic
984412571 4:179413515-179413537 CTGATTGAAAATGGTTAGGATGG + Intergenic
984620306 4:181944762-181944784 CTGTCTGCAAACACTTAGGAGGG - Intergenic
986886102 5:12238427-12238449 CGGTTTCCAAATCTTTGGGCTGG - Intergenic
988564066 5:32306753-32306775 CAGTTTGCACATCTGTATGATGG + Intronic
988818463 5:34857246-34857268 CTGTTTTCAAGTGTTCAGGAAGG + Intronic
992091666 5:73323044-73323066 TTATTTGCATATCTTTAGGAAGG - Intergenic
992130655 5:73689244-73689266 CTGTTTGCTCATTTTTAGGAAGG + Intronic
997656934 5:135562165-135562187 ATGTTTGCAAATCTCTTAGAGGG - Intergenic
997851546 5:137337251-137337273 CTATTTGCAGAGCTATAGGATGG + Intronic
998253908 5:140570552-140570574 CTGTTGCCAAATCTGTAAGATGG - Intronic
998740579 5:145196201-145196223 CTGTTTGCAGGGCTTTAAGAAGG - Intergenic
999431192 5:151526854-151526876 CTATTTGCAAACCATTAGTAGGG + Intronic
1000078668 5:157822021-157822043 ATGTGTGCAAAACTTGAGGATGG - Intronic
1000108703 5:158086260-158086282 CTGTTTCCCAAACATTAGGAAGG + Intergenic
1000476643 5:161716322-161716344 CTGTTTGCAAACCAGGAGGAGGG - Intergenic
1000543685 5:162572071-162572093 ATATTTGCAAATCTTGAGAAAGG - Intergenic
1000787205 5:165559883-165559905 ATTTTTGCAAATCTTGAGGGAGG + Intergenic
1003268823 6:4589707-4589729 ATGTGTGCATATTTTTAGGAAGG - Intergenic
1003612569 6:7626916-7626938 TTGTTTTCAAATCTCTAGGCTGG - Intergenic
1005197190 6:23301013-23301035 CTGTTTCAAAATGTTTAGAAGGG + Intergenic
1006964274 6:37966191-37966213 CTGTTTGCAATTCTGTATCATGG - Intronic
1007208428 6:40171722-40171744 CTCTTTTCAATTCTTCAGGATGG - Intergenic
1008515110 6:52311438-52311460 CAGTTTGCTAATCTGTAAGATGG + Intergenic
1008903697 6:56652922-56652944 CTGTTTACTAATCTTGAGGTTGG - Intronic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1010668740 6:78660743-78660765 CTGTTTGCAAATCTTAAAAATGG + Intergenic
1011889848 6:92144435-92144457 CCACTTGCAAATATTTAGGAGGG - Intergenic
1012157756 6:95841065-95841087 ATGTTTGCAATAGTTTAGGAAGG - Intergenic
1012994524 6:105960205-105960227 CAGTTTCAACATCTTTAGGATGG - Intergenic
1015529076 6:134202910-134202932 TTGTTTGCAAATTTTGACGATGG + Intronic
1017443083 6:154482644-154482666 ATGTATGCAAATGTCTAGGAAGG + Intronic
1018750988 6:166805636-166805658 ATGTTAGCAAATCCTGAGGAAGG + Intronic
1022537902 7:31109344-31109366 CTGTTTTCAAATCTGTAAAATGG + Exonic
1023636608 7:42217680-42217702 AAGTTTGCACATCTTAAGGAGGG - Intronic
1023653163 7:42391368-42391390 ATGCTTGCAAATCCCTAGGAAGG + Intergenic
1023766595 7:43517408-43517430 CTGTTTTCAGGTCTTTAGCAAGG + Intronic
1024810783 7:53209249-53209271 CTGTTAGCAGATCTTGATGAGGG - Intergenic
1025089903 7:56053164-56053186 CTCTTTGCAAGTCTTAGGGATGG + Intronic
1025818962 7:64945727-64945749 CTGTTTCCTTATCTTTAAGATGG - Intergenic
1027568726 7:79833842-79833864 CTGTTTCCAGATCTGGAGGAAGG + Intergenic
1027943475 7:84715464-84715486 CTATTTTCAAATATTTAGAAGGG + Intergenic
1028267063 7:88738672-88738694 CTGATTTCAATTCTTTTGGATGG + Intergenic
1031025704 7:116677354-116677376 CTGTTTGCAAATCTTGATACAGG - Intronic
1031170138 7:118283036-118283058 CTGTATTAAAATCTTTAGCAAGG - Intergenic
1031505621 7:122578489-122578511 GTGTCTTAAAATCTTTAGGAGGG + Intronic
1034759718 7:153659879-153659901 TTGTTTCCAGATCTTTAGAAGGG - Intergenic
1037007869 8:13804712-13804734 GTATTTGAAAATATTTAGGAAGG + Intergenic
1037602027 8:20405213-20405235 ATTTTTGCAAATCTTTTTGAGGG - Intergenic
1039417244 8:37406231-37406253 CTGTTTACAAATCTGTAAAATGG + Intergenic
1040748848 8:50680819-50680841 CTGTCTGCAAGTCTTTAAGCTGG - Intronic
1041686540 8:60649961-60649983 ATGTTTCCAAATCTTTAAAATGG + Intergenic
1042386612 8:68183061-68183083 TTGTTGGCAAATAATTAGGAAGG + Intronic
1043270416 8:78326409-78326431 TTGTTTGAAAAACTTGAGGAAGG - Intergenic
1047523111 8:125610728-125610750 CTGCTTGCAAATCTATGGGCTGG - Intergenic
1047531161 8:125677397-125677419 CTGTTTGGCAGTATTTAGGAAGG + Intergenic
1048271312 8:133030351-133030373 CTGTTCGCAATTCTTCTGGATGG + Intronic
1048570265 8:135647662-135647684 CTGTTTACAACTATTTATGAAGG - Intronic
1051512650 9:17896141-17896163 GTATTTGGAAATATTTAGGAAGG + Intergenic
1051727344 9:20101872-20101894 GTGTTTGTGAATCTTTAGGCAGG - Intergenic
1052015605 9:23462008-23462030 CTTTTTGGAAGTGTTTAGGAAGG - Intergenic
1052255532 9:26451852-26451874 ATGTTTGCAAATCTTCAGAAGGG - Intergenic
1055249422 9:74284473-74284495 CTATGTGCAAAGGTTTAGGATGG + Intergenic
1055756433 9:79563391-79563413 CAGTTTTCAAATTTTTAAGATGG + Intergenic
1057745074 9:97745000-97745022 CTGTTTGAACATATGTAGGATGG - Intergenic
1058754255 9:108069909-108069931 CTGTTTTCATAGCTCTAGGATGG - Intergenic
1059391384 9:114001744-114001766 CAGTTTCCAAATCTGTAAGATGG - Intronic
1060928885 9:127475588-127475610 ATGTGTGCCAATCTTGAGGAAGG - Intronic
1061384303 9:130279298-130279320 CAGTTTCCACATCTTTAGAAAGG + Intergenic
1062611760 9:137378509-137378531 CTGTTTTTAAATCTTTGGGGAGG - Intronic
1187128559 X:16478356-16478378 CTGTTTGCTACTTATTAGGATGG + Intergenic
1188110148 X:26187780-26187802 ATGCTGTCAAATCTTTAGGAAGG + Intergenic
1188256624 X:27968828-27968850 CAGTTTCCAAATCTTTAAAAGGG + Intergenic
1188864497 X:35298955-35298977 ATGTTTGCAAACTTTTAGAATGG + Intergenic
1188989944 X:36805794-36805816 CAGTTTCCAAATCATTAGTATGG + Intergenic
1189956550 X:46281020-46281042 CTTTTTGGTAATCTTTTGGATGG - Intergenic
1191061103 X:56297305-56297327 GTGTTAGCAAATGATTAGGAAGG + Intergenic
1193431029 X:81405909-81405931 CTGTGTGCAAATTTTGAAGAAGG - Intergenic
1194044016 X:88979427-88979449 CAGTTTGAAAATCTTCAGGCAGG + Intergenic
1194684525 X:96896710-96896732 ATGTTTGAAAAGCTTTAGCAAGG + Intronic
1195143565 X:101989262-101989284 ATGTATGAAAATCATTAGGAGGG - Intergenic
1198487927 X:137106883-137106905 CTGTTTCAAATACTTTAGGAGGG + Intergenic
1198494167 X:137173964-137173986 CTGTTTTCATATCTTTAAAATGG - Intergenic
1199326822 X:146508914-146508936 TTGTCTGCAAACCTTTAGGCAGG + Intergenic
1200247545 X:154534149-154534171 CTGTTGGCAAATCTGCAGGGAGG + Exonic