ID: 959563162

View in Genome Browser
Species Human (GRCh38)
Location 3:107805677-107805699
Sequence GAGCAGAAACAGAATGATCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959563161_959563162 14 Left 959563161 3:107805640-107805662 CCAGAATCTTTGAGGGTAAGGTT 0: 1
1: 0
2: 0
3: 14
4: 98
Right 959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 276
959563160_959563162 15 Left 959563160 3:107805639-107805661 CCCAGAATCTTTGAGGGTAAGGT 0: 1
1: 0
2: 0
3: 15
4: 133
Right 959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG 0: 1
1: 0
2: 2
3: 25
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959563162 Original CRISPR GAGCAGAAACAGAATGATCC TGG Exonic
900238827 1:1605253-1605275 GAGCAGAAACAGACAGAACCGGG - Intergenic
900269678 1:1780748-1780770 CAGCAGGAACAGAAGGGTCCAGG + Intergenic
900595761 1:3479489-3479511 GACCAGAGACAGCATGAGCCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901370457 1:8793216-8793238 GAGCCTAAACTGAATGATTCTGG + Intronic
901748834 1:11393377-11393399 GAGCAGACATAGAAAGGTCCTGG + Intergenic
902044436 1:13514134-13514156 GAGCAGAGTCAGAGTGACCCAGG - Intergenic
902516273 1:16991383-16991405 GAGCAGGAAGAGAAAGATTCTGG - Intronic
902680284 1:18038931-18038953 CAGCAGAAACACAATGACCTTGG + Intergenic
905419603 1:37831394-37831416 GAACAGAGACTGAATGATTCAGG - Intronic
906462684 1:46048260-46048282 GGGGAGATACAGGATGATCCTGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
908391816 1:63690111-63690133 GAGATGAAAGAGAAAGATCCTGG - Intergenic
908670876 1:66546191-66546213 GAGCAGAGGAAGCATGATCCAGG - Intronic
908902775 1:68975343-68975365 GAGCTGAAACATAATGAGACAGG + Intergenic
909507883 1:76415109-76415131 TAGCAGAAAAAGAAAGATCATGG - Intronic
909693155 1:78433375-78433397 GAGCAGAAGGAAAATTATCCTGG - Intronic
910573339 1:88730387-88730409 GAGCAGAAAGAGAGAGAGCCTGG - Intronic
911098222 1:94073160-94073182 GAACAGAAGCAGAAAAATCCAGG + Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911812629 1:102303002-102303024 GAGCAAAACCAGCATGAACCAGG + Intergenic
912906019 1:113708264-113708286 GACCAGAAACAGAGAGATGCAGG + Intronic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
915659419 1:157389831-157389853 CAGCAGAATTAGAAGGATCCAGG + Intergenic
922996880 1:229971323-229971345 GAACAGAATCAGGAAGATCCAGG - Intergenic
923155855 1:231278854-231278876 CAGCAGAAACAGCCTGGTCCTGG - Intergenic
924204448 1:241697413-241697435 GAGCTGAGACAGCAAGATCCTGG - Intronic
1063082354 10:2780374-2780396 TAGAAGAAACTGAATGACCCAGG - Intergenic
1063439273 10:6059290-6059312 GAACAGAAACAGAACAATCCAGG + Intronic
1063587575 10:7366494-7366516 TACCACAAACAGAATGAACCTGG + Intronic
1063862749 10:10329519-10329541 GGTCAGAAAAAGAATGAACCTGG - Intergenic
1063935108 10:11069537-11069559 TAGCAAAAACAGAATGCTCCAGG - Intronic
1064502684 10:15991480-15991502 GAGGTGAAACAGAATAAGCCCGG - Intergenic
1064735484 10:18378017-18378039 CAGCTGAAGCAGAATGTTCCTGG - Intronic
1065423790 10:25577600-25577622 GAGCAAAAATAGAATGAGCCCGG - Intronic
1066693587 10:38057948-38057970 GAGCAGAACCAGAATCAAGCTGG + Exonic
1067704625 10:48597707-48597729 GAGCAGAAACAGCAAGCACCTGG - Intronic
1067737957 10:48873463-48873485 GAGCAGAAACAGAGTCACCCTGG - Intronic
1067950672 10:50734794-50734816 GTCAAGAAACAGAATGATCTAGG - Intergenic
1068460909 10:57327148-57327170 GAGGAGGAACAGAAAGAACCAGG - Intergenic
1068477331 10:57545571-57545593 GAGGAGAAACAGAAAGATATAGG + Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1069739586 10:70678998-70679020 GAGGGGAAAGAGAAAGATCCAGG + Intronic
1069786208 10:70989659-70989681 TCGCAGAAACAGAATCATACAGG - Intergenic
1073508400 10:104023695-104023717 GAGCAGATACAGAATGTTTGGGG - Intronic
1074449115 10:113544899-113544921 AAGCAGAAACAGACAGAGCCAGG - Intergenic
1075622617 10:123939032-123939054 GAGCAGACACATTATGTTCCTGG + Intronic
1077994416 11:7441065-7441087 GAGAACAAACAGAATAACCCAGG + Intronic
1078105364 11:8354947-8354969 GATCAGAAACAGAAGCATTCAGG - Intergenic
1080659837 11:34286709-34286731 GAGCAGAAACAGCATGAAAATGG - Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1082568183 11:54706667-54706689 GAGGAGAAATAGAATCATCAGGG + Intergenic
1083161853 11:60859174-60859196 GAGCACAAACAGCATAAGCCAGG - Intergenic
1085320996 11:75573887-75573909 CACCTGGAACAGAATGATCCAGG - Intergenic
1085690165 11:78657940-78657962 GTGCAGAAACAAAAAGATACTGG - Exonic
1086529310 11:87764808-87764830 AATCAGAAACAAAATGCTCCTGG - Intergenic
1086738903 11:90342156-90342178 CAGCAGAAACAGAATTCTCAGGG - Intergenic
1087776283 11:102259858-102259880 GGGGAGAAAAAGCATGATCCAGG - Intergenic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1089080329 11:115771180-115771202 GAGCAGACACAGAATAAGCTGGG + Intergenic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1089802683 11:121048579-121048601 TAGCAGAAACAGAATAAAGCTGG - Intronic
1089906312 11:122043431-122043453 GAGGAGAAGTAGAAAGATCCAGG + Intergenic
1090161024 11:124495665-124495687 GAACAGAAGCAGATTGATCCTGG - Intergenic
1090719789 11:129460589-129460611 GAGCAGAAGCCAAGTGATCCTGG - Intergenic
1090726490 11:129531643-129531665 GAGTGGGAAAAGAATGATCCAGG - Intergenic
1090806688 11:130207092-130207114 CTGCAGAAACAAAATGTTCCAGG + Intronic
1091656513 12:2350507-2350529 TAGCAGAAAGAGAAAGATCAAGG + Intronic
1091987075 12:4919289-4919311 AAGCAGAAACAGATAGAACCAGG + Intronic
1092222362 12:6723784-6723806 GAACAGACACAGAATGGGCCGGG + Exonic
1092964003 12:13624374-13624396 GAAGAGAAACAGAATGAAGCAGG - Intronic
1093182434 12:15982140-15982162 GAACTGCAACAGAATGCTCCAGG + Intronic
1093943000 12:25075408-25075430 GAGCAAAAATAAAATAATCCTGG + Intronic
1095560524 12:43559813-43559835 TAGCAAAAACAGACTGTTCCTGG + Intergenic
1096836811 12:54356425-54356447 GAGAGGGAACAGTATGATCCAGG + Intergenic
1098360539 12:69650281-69650303 TTGCAAAAAGAGAATGATCCTGG + Intronic
1098593077 12:72237799-72237821 GTGCAGAAACAGACTAATTCAGG + Intronic
1099086376 12:78251645-78251667 AAGCAGAAACAGAAGTAGCCTGG + Intergenic
1099568945 12:84288917-84288939 TAGCAGGAACAGCATGACCCTGG - Intergenic
1100337199 12:93642342-93642364 GAGTTGAACCAGATTGATCCAGG + Intergenic
1100500850 12:95172709-95172731 CAGGAGGAACAGAATGATCTTGG - Exonic
1103837329 12:123833083-123833105 GAATAGAAAAAGAATGATTCAGG - Intronic
1103950150 12:124546019-124546041 GAGCAGAAACAGCCTGTGCCTGG - Intronic
1104551604 12:129762114-129762136 CATCAGGAACAGATTGATCCAGG - Intronic
1107891996 13:44922001-44922023 CAGCAGGAACAAAATGTTCCTGG + Intergenic
1109208085 13:59504076-59504098 GAGGAGAAAGGAAATGATCCAGG - Intergenic
1109956096 13:69568459-69568481 TAGCAAAAAAAAAATGATCCTGG - Intergenic
1110444408 13:75562164-75562186 TAGCATAAAGAAAATGATCCAGG - Intronic
1112172895 13:96992808-96992830 GAGCAGAACCAGAAAAACCCAGG - Intronic
1112322828 13:98422654-98422676 GAGTAGAAACAGGTTGCTCCTGG - Intronic
1112935706 13:104795368-104795390 TAGCAGAAAGAGAATGAACGTGG + Intergenic
1112946087 13:104928803-104928825 GAGCAGAAAAAGAAAGTTCCAGG + Intergenic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1115337242 14:32254110-32254132 GGGCAGAAACAGAGTAATGCAGG + Intergenic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1116759641 14:48995429-48995451 GGGCAAAAACAGAAGGAACCTGG + Intergenic
1117937904 14:60927699-60927721 GAGCAGAAACAGAAAGAAGGTGG - Intronic
1118604082 14:67490391-67490413 GGGCAGGAACAGACTGTTCCAGG + Intronic
1119371012 14:74143251-74143273 TGACAGAAACAGAATGAGCCTGG + Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119539841 14:75430677-75430699 GACAAGCAACAGAATGAGCCAGG - Intronic
1120841994 14:89094305-89094327 CAGCAGAAACAGAAGAGTCCTGG - Intergenic
1121942656 14:98087581-98087603 TAGCAGTGACAGAATGATTCTGG - Intergenic
1123700339 15:22910005-22910027 GGGCAGATACAGAATGCTGCAGG + Intronic
1124615617 15:31239730-31239752 GAGCAGAACCTGCATGACCCAGG + Intergenic
1124624924 15:31302361-31302383 GAGCAGAAAAAGGATGCTCAAGG + Intergenic
1124665063 15:31585378-31585400 GAGCAGAAACAGACAGCTTCTGG + Intronic
1126049803 15:44675523-44675545 GAGGAGGAAGAGAATGATCTTGG - Exonic
1126193372 15:45902688-45902710 GAGCACAAACTGTATGATCTAGG + Intergenic
1127025662 15:54803026-54803048 CACCAGATACAGAATGATCTGGG + Intergenic
1128631401 15:69272212-69272234 GAGAAGAAAGAGAAATATCCAGG - Intronic
1129648181 15:77457688-77457710 GAGCAGAAATAGCATGCACCTGG - Intronic
1130322461 15:82852665-82852687 GAGATGAAACAGAATAATGCAGG - Intronic
1134810081 16:17160095-17160117 GGGCAGAAACAGAAAGATCTGGG + Intronic
1137901929 16:52278051-52278073 GAGCACAAACAGAGTTATCCAGG + Intergenic
1138224215 16:55278729-55278751 GATCAGAAACAGCATTCTCCAGG + Intergenic
1138315591 16:56067072-56067094 GGGCTGAAACCAAATGATCCAGG + Intergenic
1138958750 16:62004366-62004388 GAGCAGAATCACAATCCTCCAGG + Intronic
1139093407 16:63676371-63676393 TAGCAGAAACAGACTAATACGGG - Intergenic
1140085568 16:71793006-71793028 GAACATAAACAAAATGAGCCAGG + Intronic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1143850313 17:9806364-9806386 AAGCACAAACAGAATGAACTTGG + Intronic
1146713351 17:35062102-35062124 GAGCATAAAAAGAATGAACAAGG + Intronic
1147678129 17:42221192-42221214 GAGCAGGAAGAGGATCATCCAGG + Intronic
1147687820 17:42297746-42297768 GAGCAGGAAGAGGATCATCCAGG - Intronic
1148519694 17:48260922-48260944 GAACAGAAGAAGAATGTTCCAGG - Intronic
1148657051 17:49292957-49292979 GATCAGGAAAAGAATGTTCCAGG + Intronic
1149150534 17:53558091-53558113 TAACAGAAACAGTATGATACTGG + Intergenic
1151104011 17:71591026-71591048 CAGAATAAACAGAATGCTCCAGG + Intergenic
1153264683 18:3258496-3258518 GAGCAGGAATTGAATGCTCCTGG + Intergenic
1153951472 18:10061170-10061192 GAGCAGAAACAAAGTCTTCCTGG + Intergenic
1155432611 18:25776518-25776540 GAACTGAAACAGCATGATACTGG + Intergenic
1157194565 18:45610321-45610343 GAGCATAGACAGAAAGATCTAGG + Intronic
1157363329 18:47039455-47039477 GAACAGAAAAAAAAAGATCCTGG - Intronic
1158408069 18:57178050-57178072 AAGCAGAGAGAGAAGGATCCTGG + Intergenic
1158465957 18:57690104-57690126 GGTCAGAAACAGAATGAGTCAGG + Intronic
1160046565 18:75392152-75392174 GAGCAGGAACAGGAGGACCCAGG - Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1165842065 19:38794126-38794148 GAGCTGTTACAGAAAGATCCAGG - Intergenic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
926293337 2:11548643-11548665 GAGCAGGGACAGAAGGCTCCAGG - Intronic
927627038 2:24732740-24732762 GAGCAAAAAGAGAAAGAACCTGG - Intronic
935347701 2:102124097-102124119 GTGCAGAAACAGACTAATACAGG - Intronic
937445928 2:121957803-121957825 TAGCAGAGACAGCATTATCCAGG - Intergenic
937684242 2:124678472-124678494 GAGCAGAAAAGGAATGCTCTCGG - Intronic
939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG + Intergenic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
940689195 2:156893856-156893878 TAGCATATACATAATGATCCAGG - Intergenic
940945296 2:159609532-159609554 GATCAATAACAGAATTATCCTGG - Intronic
941965473 2:171296354-171296376 GAGCAGATCCTGAATGATCAAGG + Intergenic
942375350 2:175330919-175330941 GAAATAAAACAGAATGATCCTGG + Intergenic
942533653 2:176939864-176939886 GAGTAGAAACCTAATGTTCCAGG - Intergenic
942809651 2:179982870-179982892 AAACACAAACAGAATGATCTGGG - Intronic
947416624 2:229903245-229903267 GAGCAGAAACACACAGAGCCTGG + Intronic
947511420 2:230757864-230757886 GAAAAGGAAAAGAATGATCCAGG + Intronic
947767449 2:232646799-232646821 AAGCAGAGACAGAATGTTCATGG + Intronic
948323105 2:237086747-237086769 GGGCAGAATCAGAATGCTTCAGG + Intronic
1169102606 20:2964285-2964307 GAGCAGAACAAGAATGAACCAGG - Exonic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170975317 20:21158741-21158763 GAGGAGAAGCAGGAAGATCCAGG - Intronic
1173302713 20:41818092-41818114 GGGCAGAAGCAGAAGGATCTCGG - Intergenic
1175169271 20:57068630-57068652 TAGCAGAAACAGTCTGATCAAGG + Intergenic
1175280367 20:57800195-57800217 AAGCAGCCACAGAATCATCCTGG - Intergenic
1177566929 21:22835988-22836010 GTGCCAAAACAGAATGATACTGG + Intergenic
1178385693 21:32148033-32148055 GAGCAGAATGAGAATGATACAGG + Intergenic
1178512213 21:33215026-33215048 GAACAGCAACAAAATGATTCTGG + Intergenic
1178632003 21:34269706-34269728 AAGCAGAAAAATAAAGATCCAGG + Intergenic
1180005071 21:45016882-45016904 CAGCAGAGACAGGATGACCCAGG + Intergenic
1180593064 22:16956832-16956854 GAGCAGACACACCAGGATCCTGG + Intergenic
1180620321 22:17157531-17157553 GAGCAGAAAAAGAAGAATGCAGG - Intronic
1181389271 22:22567860-22567882 AAAAAGAAAAAGAATGATCCTGG - Intergenic
1184191792 22:42899828-42899850 GAACAGAAACAGAATGATGTGGG + Intronic
1185012292 22:48320985-48321007 GAGCAGAAACAGCATGATCTGGG - Intergenic
1185143484 22:49116908-49116930 GCGCAGAGCCTGAATGATCCAGG - Intergenic
952020682 3:29015904-29015926 GAAAAGAAAAAGAATGTTCCGGG - Intergenic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
953545277 3:43859838-43859860 GAGAAGAAACAGCATCATCAGGG + Intergenic
954330171 3:49885625-49885647 GAGAAGAAACACTGTGATCCAGG + Intergenic
955375675 3:58394561-58394583 GAGCAAAGACACATTGATCCTGG + Intronic
955834835 3:63043521-63043543 GATCAGAAACAGATTCTTCCTGG - Intergenic
957293196 3:78304389-78304411 GAGAGGAAAAAGAATGATTCAGG + Intergenic
958135346 3:89482488-89482510 GATCAGACACAGATTGAACCAGG + Intergenic
958171664 3:89947104-89947126 GAGCAGCAGCAGGAAGATCCTGG + Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
959852035 3:111098796-111098818 GAGGAGAAACAGAATATTGCAGG - Intronic
960930891 3:122848514-122848536 GAGGAGAAATATAATGATCATGG - Intronic
962987540 3:140549226-140549248 GAGCAAAAACACAAAGATGCTGG + Intronic
962987696 3:140550639-140550661 GAGCAAAAACACAAAGATGCTGG + Intronic
963276712 3:143338656-143338678 GAAAAGAATCAGAATGGTCCAGG + Intronic
964140176 3:153388959-153388981 GAGCAGAAACAGTATAATTATGG - Intergenic
967830327 3:193913038-193913060 AAGCAGAAGCTGAAAGATCCAGG - Intergenic
968923761 4:3536301-3536323 GAGGAGACACAAAATGGTCCTGG - Intergenic
969199314 4:5590026-5590048 AAGCAGATACTGAAGGATCCAGG + Intronic
971347856 4:25827677-25827699 GAGTGGCCACAGAATGATCCAGG - Intronic
971408222 4:26342140-26342162 CAGCAGCAATAGAATCATCCGGG - Intronic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
975981510 4:80165875-80165897 AAGCAGAAACACAATAATCAAGG - Intergenic
976631383 4:87240536-87240558 GAGCTGAAACAAAATCATCCAGG + Intergenic
977271268 4:94919853-94919875 GAGTAGAAACAAAATGATTTAGG - Intronic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
979963939 4:127055023-127055045 GAGGAAAAACAGAATAATTCAGG - Intergenic
982300246 4:153870846-153870868 AAGCAGAAACATAATCATCTGGG + Intergenic
982506957 4:156230813-156230835 GCGCTTAAACAGAATGCTCCAGG - Intergenic
983769129 4:171526300-171526322 GAGCTGATACAAAATGAACCTGG - Intergenic
984068364 4:175079227-175079249 GAACCAAAACAGCATGATCCTGG - Intergenic
984689387 4:182708289-182708311 GACCAGGTTCAGAATGATCCAGG - Intronic
985665660 5:1180555-1180577 GAGCAGTCACAGAAAGCTCCCGG + Intergenic
986747362 5:10756274-10756296 GACCAGAAATTGAATGGTCCAGG - Intronic
988384545 5:30544252-30544274 GAACAAAAACAGAATGTTACTGG + Intergenic
990728125 5:58779024-58779046 TAGCAGAGACAGAATGAACGTGG - Intronic
990875235 5:60476796-60476818 GAGCAGAAAGGGAATGATGGCGG - Intronic
990880489 5:60532369-60532391 GAGGAGAAACAGGATAATGCAGG + Intergenic
994398381 5:99247858-99247880 GAGGAAAATCAGAATGCTCCGGG - Intergenic
997007379 5:129834050-129834072 CAGCAGAGACAGCATGATTCTGG - Intergenic
997213713 5:132093811-132093833 GAGCAGAATCAGTATCATCTGGG + Intergenic
998668632 5:144328391-144328413 GAGGAGATACAGATTGATTCTGG - Intronic
998956810 5:147447009-147447031 GAGCTGAAAAAGCAAGATCCTGG - Intronic
999505382 5:152189475-152189497 GAGAATAAACAGCATGACCCAGG - Intergenic
1000518686 5:162273106-162273128 GAGCAGAAACAGAATTAACCTGG + Intergenic
1000864958 5:166502116-166502138 CATCAGAAACAGAATGTTACTGG + Intergenic
1003315386 6:5007057-5007079 GAACAGAAACAGAATTGGCCGGG + Intergenic
1003773302 6:9331919-9331941 GTGCAGAAACAGAAGGATGGAGG + Intergenic
1005236225 6:23765129-23765151 GATCAGAAAGAGAACTATCCAGG - Intergenic
1006844074 6:37050610-37050632 ACGCAGACACAGAACGATCCTGG - Intergenic
1006954574 6:37856288-37856310 GAGAAGAAACAGAACCAGCCAGG - Intronic
1007017956 6:38488390-38488412 GGGAAGAATCAGAATTATCCAGG + Intronic
1007517012 6:42420437-42420459 GAGGAGGAACAGAATGCTGCCGG + Intronic
1008606045 6:53140626-53140648 GTGTAGGAACAAAATGATCCAGG + Intronic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1010389173 6:75317794-75317816 GAGCACACAGAGAATGAGCCTGG - Intronic
1010988943 6:82458070-82458092 CAGCAGAAACCTGATGATCCAGG - Intergenic
1011986573 6:93454754-93454776 GGGCAGAAAGAGAATGAACTTGG + Intergenic
1015087245 6:129310322-129310344 GAACAGAAACATAATACTCCTGG + Intronic
1016657797 6:146542209-146542231 GGGAAGAAACGGAATGATGCAGG - Intergenic
1016872601 6:148833559-148833581 GAGGAGAACCAGAAAGTTCCAGG + Intronic
1019822847 7:3258652-3258674 GATCAGAAACAGAGACATCCAGG + Intergenic
1019961069 7:4460232-4460254 GAGCAAAAACAAAATGTCCCAGG - Intergenic
1020641516 7:10759800-10759822 TAGCAGAAACAGTATGAACATGG - Intergenic
1022201059 7:28118214-28118236 GAGCACAAAAAGAATGTTTCTGG + Intronic
1022205858 7:28163034-28163056 GAGGAGAAACAGGAAGATACTGG + Intronic
1022789005 7:33668080-33668102 GAGCAGAAAAAAAATGAACTTGG + Intergenic
1027611177 7:80362736-80362758 GAACAGAAATAGAATAATACAGG + Intergenic
1028110570 7:86935574-86935596 CAGCAGAATCAGAATTACCCGGG + Intronic
1028287052 7:89015221-89015243 GAACCAAAACAGAATGATACTGG - Intronic
1029624352 7:101710586-101710608 AAGCAGAAACAGGATGTGCCTGG + Intergenic
1030745081 7:113155529-113155551 GAACAGTAACAGAGTGCTCCAGG + Intergenic
1030758784 7:113324410-113324432 GAGCAGAAACACAATGAGACAGG - Intergenic
1031140133 7:117933210-117933232 GAATAGAAACAGGATTATCCAGG - Intergenic
1031468722 7:122144411-122144433 GATCAGAGACAGAAGGATCTTGG - Intergenic
1033810843 7:145009076-145009098 GAGAAGATCCAGAATGGTCCAGG - Intergenic
1035479417 7:159170000-159170022 GAGCAGAAACACGATGATCATGG + Intergenic
1035479470 7:159170509-159170531 GAGCAGAAACACGATGATCATGG + Intergenic
1035916406 8:3629133-3629155 GAGCAAAGACAGAAAGAACCCGG + Intronic
1037200741 8:16249640-16249662 GGGCAGAAACAGGATGATCTTGG - Intronic
1037812174 8:22093453-22093475 GAGCAGAACCAGAATTTTCCAGG + Intronic
1037849213 8:22312560-22312582 GATCAAAAACAGAATGCTGCTGG - Intronic
1038658870 8:29479295-29479317 GAAAAGAAACAGAATGCACCTGG - Intergenic
1039676439 8:39673151-39673173 CTGCAGAAACAAGATGATCCTGG + Intronic
1042320165 8:67467499-67467521 AACCAGAAACAGAGTCATCCTGG + Intronic
1042354451 8:67811092-67811114 GAGCAGAAACTTAATGGTGCTGG - Intergenic
1042798754 8:72693752-72693774 AAGCAGAAAGAGAAAGAACCAGG + Intronic
1043091557 8:75911200-75911222 GAGCAGAAAAAAAATGATTTGGG - Intergenic
1043749004 8:83911528-83911550 CAGCAGAAACAGAGGAATCCTGG - Intergenic
1043759666 8:84051880-84051902 GAACAGTAACAGAACAATCCTGG - Intergenic
1044796713 8:95908396-95908418 CAGCAGAAACAAATTGGTCCTGG - Intergenic
1045555869 8:103213862-103213884 GTGCACAGACAGAATGAACCTGG - Intronic
1046237918 8:111451047-111451069 GAGGAGAAACAGCAGGACCCTGG + Intergenic
1046594437 8:116244702-116244724 GAACAAAGACAGAATGATCCAGG - Intergenic
1047975405 8:130125117-130125139 GAGCAGAACCTGAATGAACCTGG - Intronic
1048149960 8:131884639-131884661 GAGAAGAAACAGAGTACTCCAGG + Intergenic
1051409520 9:16775076-16775098 TAGCAGCAACAGCATCATCCAGG + Intronic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1053799473 9:41755324-41755346 GAGGAGACACAAAATGGTCCTGG - Intergenic
1054145742 9:61559673-61559695 GAGGAGACACAAAATGGTCCTGG + Intergenic
1054187882 9:61967385-61967407 GAGGAGACACAAAATGGTCCTGG - Intergenic
1054465484 9:65490777-65490799 GAGGAGACACAAAATGGTCCTGG + Intergenic
1054650632 9:67621196-67621218 GAGGAGACACAAAATGGTCCTGG + Intergenic
1054812417 9:69445547-69445569 GAGCAGAACCATGATGCTCCTGG + Intronic
1055476525 9:76668598-76668620 GAGGAGTGAGAGAATGATCCAGG - Intronic
1057112871 9:92490849-92490871 GAGCAGAAAAAGATTTATACAGG - Intronic
1057208930 9:93189116-93189138 CAGCAGAAACAGGAAGGTCCGGG - Intronic
1057816458 9:98299499-98299521 GAGGAGATGCAGAAGGATCCTGG + Intronic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1061368799 9:130186543-130186565 CAGCAGGAACAGCATGTTCCAGG + Intronic
1061754688 9:132804353-132804375 GAGCAGAAACAGGGGGATCCTGG + Intronic
1061919025 9:133772112-133772134 CAGCAAACACAGAATGAGCCTGG - Intronic
1062320525 9:135988616-135988638 GAGCAGATGCGGAATGCTCCCGG - Intergenic
1187284842 X:17895178-17895200 CAGCAGGAACAGAAGTATCCTGG - Intergenic
1187764711 X:22628411-22628433 GAGAAGAAACAGAAGGGTTCAGG - Intergenic
1189337945 X:40182177-40182199 GAGCAGAAACAGCAAGATTCTGG - Intergenic
1192177155 X:68893251-68893273 GAGCAGAAAGGGCATGAGCCAGG - Intergenic
1193494418 X:82193088-82193110 GAACCAAAACAGAATGATACTGG - Intergenic
1194265775 X:91752050-91752072 AAGCAGAAACACAGTGATCAGGG - Intergenic
1194300836 X:92183705-92183727 TGGCAGGAACAGAATGATCAAGG - Intronic
1194906388 X:99581562-99581584 TAGCAGAAACCAAATAATCCTGG - Intergenic
1195656169 X:107333432-107333454 GAACAGAATCTGAATTATCCTGG + Intergenic
1196070844 X:111519915-111519937 GAGCAGAAATAAAATGATGTTGG + Intergenic
1196916156 X:120537009-120537031 ATGCAGAATCAGAATGTTCCGGG - Exonic
1197134117 X:123041213-123041235 GAGGTGAATCAAAATGATCCAGG + Intergenic
1200928632 Y:8676977-8676999 AAGCAGAAAAAGAATCATACAGG + Intergenic