ID: 959563665

View in Genome Browser
Species Human (GRCh38)
Location 3:107812468-107812490
Sequence CAGTATATGCAGAAGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959563662_959563665 15 Left 959563662 3:107812430-107812452 CCTTTTTACCTTTTTGAAATTAT 0: 1
1: 0
2: 6
3: 109
4: 1281
Right 959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 239
959563664_959563665 7 Left 959563664 3:107812438-107812460 CCTTTTTGAAATTATAGGAATTT 0: 1
1: 0
2: 2
3: 62
4: 708
Right 959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959563665 Original CRISPR CAGTATATGCAGAAGTAGAG AGG Intergenic
904254055 1:29243482-29243504 CAGTGTGTGCAAAGGTAGAGAGG - Intronic
904875571 1:33652054-33652076 CAGTATCTTCAGAGGTAGAGAGG + Intronic
907377759 1:54057884-54057906 CAGTATATGCAAAGGCACAGAGG - Intronic
907693502 1:56696096-56696118 CAGCATATGCATCAGGAGAGTGG - Exonic
907696877 1:56740012-56740034 CATTATATGCAGGAGAAAAGTGG + Intronic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
909440712 1:75692504-75692526 GATTCTATGCAGAAGTAGAAGGG + Intergenic
911199435 1:95029773-95029795 CATCATATGAAGAAGCAGAGTGG - Intronic
916364486 1:164009101-164009123 GAATATATGCAGAAGAACAGAGG - Intergenic
916461040 1:165024687-165024709 CTCTATATCGAGAAGTAGAGAGG - Intergenic
918498389 1:185165535-185165557 AAGCAAATGCAGAAGTAGGGAGG - Intronic
919643187 1:200065523-200065545 CAGTATATGCACACATCGAGGGG + Intronic
1062778419 10:176133-176155 CAGTTTGTGTAGAAGTAGTGTGG + Intronic
1065334453 10:24642033-24642055 CAGCATACACAAAAGTAGAGAGG + Intronic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1065709536 10:28502178-28502200 CAGTAAATGCAAAATTACAGTGG + Intergenic
1068789452 10:61011043-61011065 CAGTGTATGCATATGAAGAGAGG - Intergenic
1069088346 10:64168962-64168984 CAGTAAATGTAGAAGTTGAAGGG + Intergenic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1071018754 10:81028135-81028157 CAATCTATGCAGAGGAAGAGTGG - Intergenic
1071120322 10:82269305-82269327 AAGCATATGCTGAACTAGAGAGG - Intronic
1071145730 10:82568524-82568546 GAATATGTGCAGAAGTAAAGGGG - Intronic
1072172350 10:92877736-92877758 AAGTATATCCAGAAGTAGTATGG - Intronic
1072641877 10:97217297-97217319 CATTATATGGAGAAGTAGAGTGG + Intronic
1074702875 10:116107867-116107889 CAGAATATGCAGAATTAAAATGG + Intronic
1074727864 10:116332312-116332334 CAGTAAAAGCAAAAGTAGAAAGG - Intronic
1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG + Intergenic
1077552562 11:3207535-3207557 CAGCATATGCACAGGGAGAGGGG - Intergenic
1079953283 11:26830966-26830988 GAGTATGAGCAGAAGTAGACTGG + Intergenic
1083611935 11:64008462-64008484 CACTAAATGCAGCAGTGGAGGGG + Intronic
1083896820 11:65624225-65624247 CAGCAGATGCAGAAGTAGACAGG - Exonic
1084873914 11:72116840-72116862 CAGCATGTGCAGAAGTGCAGAGG + Intronic
1084961452 11:72718825-72718847 CAGCTTGTGCAGAAGTTGAGAGG + Intronic
1086107557 11:83162415-83162437 CAGTATATGCAGAAGAAATCTGG + Intronic
1086420418 11:86632609-86632631 CAGTGTATGCAGTACTGGAGGGG - Intronic
1086928777 11:92669656-92669678 CAGTATATCCAGAGGTGGGGTGG + Intronic
1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG + Intergenic
1087623581 11:100569922-100569944 GAGGATTTGCAGAAGTAGACAGG - Intergenic
1087960582 11:104343553-104343575 GAATAAATGAAGAAGTAGAGAGG + Intergenic
1089176783 11:116554355-116554377 CAGCATATGCAAAAGTGCAGAGG + Intergenic
1090445395 11:126760647-126760669 CAGGATCTGCAGGAGTTGAGAGG + Intronic
1090527920 11:127557266-127557288 CAGTGTGTGAGGAAGTAGAGGGG + Intergenic
1094028013 12:25979615-25979637 CAGTTTTTGCAGAAGTAAAATGG - Intronic
1095257907 12:40061944-40061966 CAGTATATACAGAAAAAGAAAGG + Intronic
1095610046 12:44117206-44117228 CAATATATGCAAAAGTAAGGAGG - Intronic
1097612263 12:61838743-61838765 CAGGTCTTGCAGAAGTAGAGTGG + Intronic
1098970165 12:76846098-76846120 TATTATGTGCAGAGGTAGAGAGG + Intronic
1100771958 12:97933505-97933527 CAATATATGAAGTAGTTGAGAGG - Intergenic
1101485394 12:105152862-105152884 CATTATATGCACAAGTAAAATGG - Intronic
1102652745 12:114454296-114454318 AAACATATGCAGAAGTAGAAAGG - Intergenic
1102883453 12:116503940-116503962 CAGCATATGCAAAAGTATACAGG - Intergenic
1104108622 12:125686288-125686310 AAGTGGATGCAGAAGTGGAGAGG + Intergenic
1106135818 13:26972594-26972616 CAGTTTATGGAGAAGCTGAGTGG - Intergenic
1107725083 13:43291217-43291239 AAGGATGTGCAGAAGTAGTGAGG - Intronic
1107961544 13:45563646-45563668 CAGTACATGCAGAAGGGGAGAGG + Intronic
1108722090 13:53142535-53142557 CAGTATATGCAAAAGTGCAAAGG - Intergenic
1109327600 13:60887616-60887638 CAGGTAATGCAGAAGTAGTGGGG + Intergenic
1109748335 13:66656209-66656231 CAGTATATGCACAAGCACTGTGG + Intronic
1109909200 13:68888606-68888628 CAGCATTTGCAGAACTATAGTGG + Intergenic
1110895697 13:80749586-80749608 CAGCATGAGCAGAACTAGAGTGG + Intergenic
1112039870 13:95536027-95536049 CAGTGGATGGAGAAGTAGATGGG + Intronic
1112283277 13:98081383-98081405 CAGTTTATGCAGAGGTAAACTGG - Intergenic
1113026654 13:105948159-105948181 CAGCATTTCCAGTAGTAGAGTGG - Intergenic
1113184321 13:107670044-107670066 CAGTAGATGGTGAAGTAGAAAGG - Intronic
1116294305 14:43086800-43086822 CAGAAAAGGCAGAGGTAGAGGGG - Intergenic
1117166164 14:53036112-53036134 CAGCAAATGCAAAGGTAGAGAGG + Intergenic
1117186725 14:53247291-53247313 CAGTATATGCAAAAGCACGGAGG + Intergenic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120288987 14:82542736-82542758 CAGTATATGTTGAAGAGGAGTGG + Intergenic
1120541693 14:85759118-85759140 CAGTACATTCAGAAGTAGCTTGG - Intergenic
1121397012 14:93634523-93634545 CAGTATAGGCAGATGAAAAGGGG + Exonic
1125160463 15:36637559-36637581 CAGTATCTGCTGAAGTGGAGAGG + Intronic
1125856968 15:42959804-42959826 CAGCATATGCACATGTACAGTGG + Intronic
1126213873 15:46132159-46132181 CAGTCTGTGCAGTGGTAGAGCGG + Intergenic
1129241299 15:74253694-74253716 CAGGATTTGCATAAGTAGATTGG - Intronic
1129556114 15:76511619-76511641 CAGTTTATGCAAAAGCACAGAGG - Intronic
1129662282 15:77559807-77559829 CATAATATCCAGAAGGAGAGAGG + Intergenic
1130078511 15:80710617-80710639 CAGTATTTGCTGATGCAGAGTGG + Intronic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1130630686 15:85565818-85565840 AATCATATGCAGAAATAGAGTGG - Intronic
1132416752 15:101625810-101625832 CAGTCTATGCACCAGTGGAGTGG - Intronic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1135499980 16:22987221-22987243 AAGCACATACAGAAGTAGAGAGG + Intergenic
1136193284 16:28631771-28631793 AAGTCCATACAGAAGTAGAGAGG - Intergenic
1138452246 16:57100285-57100307 CAGCATATGCAGAATTAGGGAGG + Intronic
1139225298 16:65228731-65228753 TAATATATGAAGCAGTAGAGAGG + Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143930931 17:10423318-10423340 AAACATATGCAAAAGTAGAGGGG + Intergenic
1144169935 17:12649789-12649811 GGGTATGTGCAGAAGGAGAGGGG + Intergenic
1146489158 17:33267759-33267781 CAGGATACCCAGAAGTGGAGGGG + Intronic
1146601620 17:34222030-34222052 CAGTATCTGCAGCTGTAGAGTGG - Intergenic
1146643296 17:34557117-34557139 CAGTATTTGCAGAAGCTGGGAGG + Intergenic
1148725247 17:49784572-49784594 CAGAATGTGCAATAGTAGAGAGG - Intronic
1149957686 17:61071014-61071036 CAGTATATGCATAAGTTAAAGGG - Intronic
1150543544 17:66129287-66129309 AAGTATTTGGAGAGGTAGAGAGG - Intronic
1151209614 17:72534682-72534704 CAGCATATGCAGAGGCACAGAGG - Intergenic
1153537858 18:6121951-6121973 ATGTATATGCAGAACTGGAGTGG - Intronic
1153664176 18:7353198-7353220 GAGTATTTTCAGCAGTAGAGGGG - Intergenic
1155205968 18:23558083-23558105 TAGTAAATGCAGAGGAAGAGAGG + Intronic
1156080286 18:33326251-33326273 CAGCAGATGCTGAAGTACAGGGG + Intronic
1156654535 18:39269572-39269594 CAGTATATCCTGTAGTAAAGAGG - Intergenic
1156859828 18:41822982-41823004 CATTATATCCAGCACTAGAGTGG + Intergenic
1157484580 18:48077927-48077949 ATGTCTATGCAGAATTAGAGGGG + Intronic
1158178287 18:54682668-54682690 TAATATATGGAGAAGGAGAGGGG - Intergenic
1158513157 18:58109410-58109432 CAGCATGTGCAGAAGTCTAGAGG + Intronic
1160047733 18:75402704-75402726 CAGCAGAAGCAGAAATAGAGAGG + Intergenic
1160349761 18:78166713-78166735 CAGTATATGTAGATGGAGAGGGG + Intergenic
1162126038 19:8499956-8499978 CACTAAATGGAGAAGTAGGGAGG - Intronic
1162688852 19:12412280-12412302 CAGTATGTGCGGAACAAGAGAGG - Intronic
1163098409 19:15078143-15078165 CAGTAAAGACAGAAGTAGCGGGG - Intergenic
1163752147 19:19084252-19084274 CTGACTATGCAGATGTAGAGGGG - Intronic
1164789683 19:30965462-30965484 TAGTAGAGGGAGAAGTAGAGAGG + Intergenic
1165426227 19:35746843-35746865 CAGTATGTGCAGAAGTTGTCAGG - Exonic
1165601451 19:37058417-37058439 CAGTCCATCCAGAAGCAGAGGGG - Intronic
1166242575 19:41504316-41504338 CATAATATCCAGAAGAAGAGAGG - Intergenic
927066368 2:19475264-19475286 CAGTATTTCCAGTAGTAGAGGGG - Intergenic
928345106 2:30485944-30485966 AAATATATGCTGAAGTAGAAAGG - Intronic
928824053 2:35397242-35397264 CAGTTTAGAAAGAAGTAGAGAGG - Intergenic
929612720 2:43283868-43283890 CAGAATTTGCATAAGTAAAGAGG + Intronic
931413307 2:62056072-62056094 CAGTATATGCACAGACAGAGTGG + Intronic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
936731536 2:115387050-115387072 CAACATATGATGAAGTAGAGAGG + Intronic
936913488 2:117616092-117616114 CAGTACTGGCAGAAGCAGAGTGG - Intergenic
938050074 2:128161527-128161549 AAATATATGCAGAAGTAAAGAGG + Intronic
938141914 2:128801284-128801306 CAGTATATTCCAAAGTAGTGAGG - Intergenic
939805404 2:146769690-146769712 CAGAAAATGCTGGAGTAGAGGGG + Intergenic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
942088972 2:172469944-172469966 GAGTAAATGGAGATGTAGAGAGG + Intronic
943354681 2:186837195-186837217 CAGTATATGCAGGAAGAGGGAGG + Intronic
943904018 2:193474972-193474994 CAGGATATTGAGAAGTACAGAGG - Intergenic
944763710 2:202842751-202842773 GAGTTTAAGCAGAAGAAGAGAGG - Intronic
947959606 2:234224699-234224721 CAGAATCTGCAGAAAGAGAGGGG - Intergenic
1170001505 20:11619728-11619750 CAATAGATGCAGAGGTATAGTGG - Intergenic
1171333810 20:24364869-24364891 CAGAATATGAAGAAGGACAGTGG - Intergenic
1173284735 20:41659949-41659971 AAGTATATTCAGCAGCAGAGGGG - Intergenic
1173457022 20:43211108-43211130 CAGTGTGTGCTGAAGTAGTGAGG - Intergenic
1177298279 21:19205238-19205260 CAACATATGCAGAGGTAAAGCGG - Intergenic
1179841012 21:44073556-44073578 AAGTAAATACAGAAGCAGAGAGG + Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180578340 22:16803157-16803179 AAGTATATGCAAAAGTGGAAAGG - Intronic
1181435673 22:22909228-22909250 CAGGAAACGCAGAAGCAGAGAGG - Intergenic
1181518504 22:23432083-23432105 CAGTATTTGTAGAATTAGCGAGG - Intergenic
1183762310 22:39832967-39832989 CAGTCTGTGCAGAAGCCGAGTGG + Intronic
1184436766 22:44483645-44483667 CAGTAAATGGAGAAATAAAGTGG + Intergenic
1184719151 22:46299439-46299461 CAGGGTATGCAGATGCAGAGGGG - Intronic
949112118 3:273834-273856 CAGTATAGGCAAGAGTAGATTGG - Intronic
949704172 3:6796891-6796913 CATTATATACAGATGTATAGGGG + Intronic
953011714 3:39032073-39032095 AAGTATATTTAGAAGTACAGGGG - Intergenic
953311026 3:41879460-41879482 CAACATATATAGAAGTAGAGAGG - Intronic
954430338 3:50467463-50467485 CAGTAGATGGAGAAGCAAAGCGG - Intronic
957230645 3:77509921-77509943 CAGCATAAGCAGAAGTAGTTGGG + Intronic
959523643 3:107349921-107349943 GACTATATGGAGAAGGAGAGGGG - Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
961099005 3:124182623-124182645 CAGTATATACTCAAGGAGAGAGG + Intronic
962812858 3:138974002-138974024 CAGGATTTGGATAAGTAGAGAGG - Intergenic
963229932 3:142899192-142899214 CGGTATAGGTGGAAGTAGAGTGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963853081 3:150226902-150226924 CAGTATCTTCAGAACTAGAGAGG + Intergenic
966509950 3:180751031-180751053 TGGTATATGCACAAGGAGAGAGG - Intronic
967281135 3:187824769-187824791 CAGTATATGCATGAGGAGGGTGG - Intergenic
967488695 3:190063786-190063808 CAGGATATGCAGAAAAAGATGGG + Intronic
967659050 3:192082966-192082988 CAGTATATGCATGAATGGAGTGG - Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG + Intergenic
973025017 4:45257791-45257813 CAGTACATGTAGGATTAGAGAGG + Intergenic
979231888 4:118355615-118355637 TAGTATATGCCAAAGGAGAGGGG + Intergenic
980038442 4:127911897-127911919 CAATATATACAGAAGTAGATGGG + Intergenic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
980540706 4:134190219-134190241 CACTATATCCAAAATTAGAGAGG - Intergenic
980581537 4:134761126-134761148 CAGTTTATACAGAAGCAGACAGG + Intergenic
981004927 4:139865118-139865140 CACTATTTGCAGAATTAAAGAGG - Intronic
981070503 4:140531465-140531487 CTGTATATGCGTAAGTACAGTGG - Intronic
981912986 4:150003580-150003602 CAAGATTTGCAGAAGTAAAGGGG + Intergenic
982467638 4:155750021-155750043 GGATATATGTAGAAGTAGAGTGG + Intergenic
982577043 4:157125970-157125992 CACTATCTGCTGAAGTAGAATGG - Intronic
984839306 4:184053184-184053206 CAGCACATTCAGAAGTAGAGAGG + Intergenic
987466650 5:18279832-18279854 CATTATACGCTGAAGTAAAGGGG - Intergenic
989365312 5:40649392-40649414 GAGCATATGCAGAAGTAAAATGG - Intergenic
989479241 5:41910158-41910180 CAGCATCTGCAAAAGTAAAGGGG - Intronic
990420691 5:55630223-55630245 CATGGAATGCAGAAGTAGAGAGG + Intronic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
994392444 5:99203575-99203597 CAGAATATTCAGAGGAAGAGAGG - Intergenic
996303902 5:122023932-122023954 CAGTAGATGCTGAATGAGAGCGG - Intronic
997900446 5:137758883-137758905 CAGTATATGCACAGACAGAGTGG - Intergenic
998253936 5:140570800-140570822 CAGTATAAGCAAAAGTTCAGAGG - Intronic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
1002204855 5:177555293-177555315 CAGTATATTCACAAAAAGAGGGG - Intergenic
1003203760 6:3988640-3988662 AAGGATATTCAGAAGTAAAGGGG + Intergenic
1004272105 6:14204727-14204749 TACTGTATGCAGAACTAGAGAGG + Intergenic
1004434158 6:15574367-15574389 CAGTATATGCAGGAGTTGCCTGG + Intronic
1004733979 6:18386508-18386530 CAGTGGTTGCAAAAGTAGAGAGG + Intergenic
1006730087 6:36230225-36230247 CAGGATATGCAGGAGTCGGGTGG - Intronic
1007099038 6:39231914-39231936 CAGGAAATGCAGAAACAGAGTGG - Intergenic
1007892188 6:45305970-45305992 AGGTATATGCAGAATTAGAGAGG - Intronic
1008730706 6:54479458-54479480 CAGTCAATGCAGAAGTAGATAGG + Intergenic
1008762263 6:54866068-54866090 CAGTTTGGGCAGATGTAGAGAGG - Intronic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009226464 6:61024444-61024466 CATAATATCCAGAAGTGGAGAGG + Intergenic
1010387694 6:75301557-75301579 TAGCATTAGCAGAAGTAGAGAGG + Intronic
1012154980 6:95807865-95807887 CAGTAGATGCAGAAAGAGACAGG + Intergenic
1012351821 6:98260822-98260844 GGGCATATGCAGAAGGAGAGAGG + Intergenic
1012377418 6:98579224-98579246 AAGTATATGCAAAAGTGAAGAGG - Intergenic
1013130121 6:107224568-107224590 CTGTATATGCAGAGGTAGTCAGG - Intronic
1013669488 6:112383870-112383892 AAGTATGTGAAGAAGTAGATTGG + Intergenic
1015024212 6:128513907-128513929 CAGTAAATTCAAGAGTAGAGAGG - Intronic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019600059 7:1876861-1876883 CAGTATTTGTAGAATTAGCGAGG + Intronic
1020188902 7:5979642-5979664 CAGTAAATCCAGGAGGAGAGAGG - Intronic
1027459138 7:78430487-78430509 AAGTATATTCAGAAATAGAGGGG - Intronic
1028195941 7:87908133-87908155 CAGTAAATGTAGAAGTTGAAGGG - Exonic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1030228325 7:107177584-107177606 TAGCATATTCAGTAGTAGAGGGG + Intronic
1030964569 7:115974585-115974607 CAGTATCTACATAAATAGAGTGG + Intronic
1031351875 7:120742858-120742880 CAGTTAATGCAGATGAAGAGTGG + Intronic
1032142206 7:129342131-129342153 AATTATATGCAAAAGTACAGGGG + Intronic
1038622005 8:29153187-29153209 CAGTATATTAAGGAGTAAAGAGG + Intronic
1038637527 8:29299815-29299837 CATAATATCCAGAAGGAGAGAGG + Intergenic
1041150028 8:54922558-54922580 CAGCATATGCAAAAGCAAAGAGG + Intergenic
1041521637 8:58763220-58763242 CAGTATACTCAGAAGGGGAGAGG - Intergenic
1042651399 8:71045888-71045910 CAGTAGCTGCAGAAGGAAAGAGG + Intergenic
1043111905 8:76196091-76196113 TAGTAAAAGCAGAATTAGAGAGG + Intergenic
1043251181 8:78075415-78075437 CAGTATATGCAAAGTTAGACAGG + Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1046149749 8:110208135-110208157 CGGCATGTGCAGAAGTACAGTGG + Intergenic
1046410863 8:113840939-113840961 CATTATATACAGAAGTATATGGG - Intergenic
1047642356 8:126834021-126834043 CAACATATGCACAAGTGGAGGGG + Intergenic
1047646210 8:126873280-126873302 CAACATATGCAGAAGCAGTGCGG + Intergenic
1050408191 9:5332251-5332273 TTGTATGTGCAGAAGTAGACTGG + Intergenic
1052733752 9:32319035-32319057 CAGAATATTCAGAAGAATAGAGG - Intergenic
1054972307 9:71102555-71102577 GAGTATGTGCAGAAGCAGTGTGG - Intronic
1055361000 9:75490205-75490227 CAGTATTTGGAGGAGTAGAGTGG - Intergenic
1055871152 9:80881444-80881466 CAGCATATGCAGAAATTGTGCGG - Intergenic
1058485725 9:105441862-105441884 GAGTATATGCAGAGGGATAGGGG + Intergenic
1059001510 9:110353399-110353421 CAGCATACACAAAAGTAGAGAGG + Intergenic
1059541446 9:115134423-115134445 CAGCATATGCAAAAGCAAAGAGG + Intergenic
1059790504 9:117636997-117637019 CAAGATATGCAGAACCAGAGAGG + Intergenic
1059866872 9:118524449-118524471 CAGTTTTTGCAGAAATAGAAAGG + Intergenic
1060131646 9:121106033-121106055 CAGAATATTCAAAAGTGGAGTGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1061324771 9:129857118-129857140 CAGTCTTTGCAGAAGTGCAGGGG + Intronic
1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG + Intergenic
1187038473 X:15567206-15567228 AAGTATATGAAGCAGGAGAGAGG - Intronic
1187579698 X:20594565-20594587 TAGGATATGTAGAAGTAGAAGGG - Intergenic
1187665248 X:21601311-21601333 CAGGATATGCAGAAAGAGAGAGG + Exonic
1188600433 X:31956995-31957017 CAGTGTCTGCAGTGGTAGAGTGG + Intronic
1188981661 X:36732386-36732408 CAGAATGTGCATAAGTGGAGTGG - Intergenic
1188986058 X:36769314-36769336 AAGTATGTGCTGAAGTAGAAGGG - Intergenic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1190223485 X:48528308-48528330 AAGTAAAACCAGAAGTAGAGAGG - Exonic
1190432306 X:50389964-50389986 TAGTATATAAGGAAGTAGAGGGG - Intronic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1194318131 X:92407829-92407851 CAGTATCTGCAAAAGTGTAGGGG - Intronic
1194493145 X:94576532-94576554 TAGTATATGCAAAAGTACAGAGG - Intergenic
1194936142 X:99951378-99951400 CAGAAAATGCAGAAATATAGTGG + Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1197900057 X:131361256-131361278 TTGTATGTGCAGAAGTAGACTGG - Intronic
1198308179 X:135403075-135403097 CAGTATTTGCAAAAGGGGAGGGG - Intergenic
1198853789 X:140994935-140994957 CAGGATATGCAAAGGCAGAGAGG - Intergenic
1200626301 Y:5521118-5521140 CAGTATCTGCAAAAGTGTAGGGG - Intronic