ID: 959567228

View in Genome Browser
Species Human (GRCh38)
Location 3:107844846-107844868
Sequence AGATGTCCTTCATGCAGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959567228_959567231 5 Left 959567228 3:107844846-107844868 CCTAGACTGCATGAAGGACATCT No data
Right 959567231 3:107844874-107844896 GGCCACAGAAACACTGAGCAGGG No data
959567228_959567233 12 Left 959567228 3:107844846-107844868 CCTAGACTGCATGAAGGACATCT No data
Right 959567233 3:107844881-107844903 GAAACACTGAGCAGGGAGAATGG No data
959567228_959567230 4 Left 959567228 3:107844846-107844868 CCTAGACTGCATGAAGGACATCT No data
Right 959567230 3:107844873-107844895 AGGCCACAGAAACACTGAGCAGG No data
959567228_959567235 28 Left 959567228 3:107844846-107844868 CCTAGACTGCATGAAGGACATCT No data
Right 959567235 3:107844897-107844919 AGAATGGCGGTAGTGTTTAAAGG No data
959567228_959567234 15 Left 959567228 3:107844846-107844868 CCTAGACTGCATGAAGGACATCT No data
Right 959567234 3:107844884-107844906 ACACTGAGCAGGGAGAATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959567228 Original CRISPR AGATGTCCTTCATGCAGTCT AGG (reversed) Intergenic
No off target data available for this crispr