ID: 959567230

View in Genome Browser
Species Human (GRCh38)
Location 3:107844873-107844895
Sequence AGGCCACAGAAACACTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959567228_959567230 4 Left 959567228 3:107844846-107844868 CCTAGACTGCATGAAGGACATCT No data
Right 959567230 3:107844873-107844895 AGGCCACAGAAACACTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959567230 Original CRISPR AGGCCACAGAAACACTGAGC AGG Intergenic
No off target data available for this crispr