ID: 959568000

View in Genome Browser
Species Human (GRCh38)
Location 3:107852458-107852480
Sequence GATTAGTACTCTCACGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959567995_959568000 22 Left 959567995 3:107852413-107852435 CCTTGGGAGGTGATTAGGTCATG 0: 21
1: 63
2: 197
3: 251
4: 563
Right 959568000 3:107852458-107852480 GATTAGTACTCTCACGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959568000 Original CRISPR GATTAGTACTCTCACGAAGA AGG Intergenic
No off target data available for this crispr