ID: 959568835

View in Genome Browser
Species Human (GRCh38)
Location 3:107860357-107860379
Sequence CCTTCCAGGTAGAAATGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959568829_959568835 18 Left 959568829 3:107860316-107860338 CCAGGGTTGAGATGTATTGTTTA No data
Right 959568835 3:107860357-107860379 CCTTCCAGGTAGAAATGGGTAGG No data
959568827_959568835 30 Left 959568827 3:107860304-107860326 CCCAACTTGCAGCCAGGGTTGAG No data
Right 959568835 3:107860357-107860379 CCTTCCAGGTAGAAATGGGTAGG No data
959568830_959568835 -7 Left 959568830 3:107860341-107860363 CCAACTGCACTGATTTCCTTCCA No data
Right 959568835 3:107860357-107860379 CCTTCCAGGTAGAAATGGGTAGG No data
959568828_959568835 29 Left 959568828 3:107860305-107860327 CCAACTTGCAGCCAGGGTTGAGA No data
Right 959568835 3:107860357-107860379 CCTTCCAGGTAGAAATGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959568835 Original CRISPR CCTTCCAGGTAGAAATGGGT AGG Intergenic
No off target data available for this crispr