ID: 959572413

View in Genome Browser
Species Human (GRCh38)
Location 3:107899190-107899212
Sequence CTGGTAAGGCAGAGCTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959572413_959572421 12 Left 959572413 3:107899190-107899212 CCCTGCCAGCTCTGCCTTACCAG No data
Right 959572421 3:107899225-107899247 TCTCCCAGCGGCTGCAATGCTGG No data
959572413_959572419 0 Left 959572413 3:107899190-107899212 CCCTGCCAGCTCTGCCTTACCAG No data
Right 959572419 3:107899213-107899235 CTGGTGCACCTGTCTCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959572413 Original CRISPR CTGGTAAGGCAGAGCTGGCA GGG (reversed) Intergenic
No off target data available for this crispr