ID: 959575397

View in Genome Browser
Species Human (GRCh38)
Location 3:107927898-107927920
Sequence GGCGGGGAAGAGGACGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 9, 3: 18, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959575395_959575397 -9 Left 959575395 3:107927884-107927906 CCATTACTGCGCGCGGCGGGGAA 0: 1
1: 0
2: 0
3: 0
4: 14
Right 959575397 3:107927898-107927920 GGCGGGGAAGAGGACGCCGCCGG 0: 1
1: 0
2: 9
3: 18
4: 276
959575388_959575397 25 Left 959575388 3:107927850-107927872 CCGGCATTATCTTCCTCTTTTAG No data
Right 959575397 3:107927898-107927920 GGCGGGGAAGAGGACGCCGCCGG 0: 1
1: 0
2: 9
3: 18
4: 276
959575390_959575397 12 Left 959575390 3:107927863-107927885 CCTCTTTTAGGACGCAGAGATCC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 959575397 3:107927898-107927920 GGCGGGGAAGAGGACGCCGCCGG 0: 1
1: 0
2: 9
3: 18
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959575397 Original CRISPR GGCGGGGAAGAGGACGCCGC CGG Intergenic
900300201 1:1973310-1973332 GTCTGGGAAGAGGACGGTGCAGG + Intronic
901526270 1:9824811-9824833 GGCGAGGAGGAGGGGGCCGCTGG - Intergenic
901646703 1:10720771-10720793 GGGGAGGAAGTGGACGCCGGTGG + Intronic
902039656 1:13483522-13483544 GGCTGGGAAGATGAAGCCACTGG + Intronic
902965159 1:19995796-19995818 GGCTGGGAAAAGGAGGCCCCTGG + Intergenic
903274300 1:22210931-22210953 TGGGGGGAAGAGGATGCCCCTGG + Intergenic
905066827 1:35192043-35192065 GGCGGGGGATTGGCCGCCGCCGG - Intronic
905124662 1:35708211-35708233 GCCGGGGAAGAGGTAGCCGGCGG - Intergenic
905375017 1:37514411-37514433 GGAGGGGAAGCGGCAGCCGCAGG - Intronic
906090239 1:43172545-43172567 GGCGCGGAGGAGGACCCCGGGGG + Exonic
906615831 1:47232238-47232260 GGCGGGGGAGCGGGGGCCGCGGG - Intergenic
907040988 1:51259165-51259187 GGCAGGGAAGAGGGTGCCACTGG + Intronic
907513808 1:54980823-54980845 GGCGGCGGAGAGGGCGCGGCTGG + Exonic
908252019 1:62273209-62273231 GGCGGGGAGGAGGAGGAGGCCGG + Exonic
908953099 1:69586502-69586524 GGCGGGGGACAGGATGCAGCAGG + Intronic
911144796 1:94541791-94541813 GGCGCGGGAGAGCGCGCCGCCGG - Exonic
912910931 1:113758953-113758975 GGAGGGGCAGGGGCCGCCGCTGG + Intronic
915557492 1:156668660-156668682 GGCGGGGGAGAGGAGGAAGCTGG - Intergenic
915570185 1:156741092-156741114 GGCGGGGGAGGGGACGCTGAGGG - Intronic
915718481 1:157966093-157966115 GGAGGGGAAGTGGAGGCCTCTGG - Intergenic
921325318 1:213982746-213982768 GGCGGGGGAGGAGAGGCCGCGGG + Intergenic
922110138 1:222548148-222548170 GGCGGGGAAGAGGAGGAAGGAGG - Intergenic
922812492 1:228425344-228425366 GTCTGGGCAGAGGACACCGCGGG - Intergenic
922934219 1:229411325-229411347 GGAGGGGAAGAGGAGGCCGAGGG - Intergenic
924383440 1:243483272-243483294 TGCGGGGACGAGGGCGCCGGCGG - Intronic
1068910529 10:62374454-62374476 GTCGGGTAAGAGGCGGCCGCCGG + Exonic
1070148780 10:73792763-73792785 GGCGAGGAAGAGAAGGCCGAGGG + Exonic
1070398904 10:76035816-76035838 GGCGGGGGAGAAGGGGCCGCTGG - Intronic
1072680084 10:97499572-97499594 GCCGGGGGCGAGGGCGCCGCTGG + Intronic
1076035587 10:127196442-127196464 GGCGGGGCAGAGGAGGGAGCAGG + Intronic
1076792669 10:132785486-132785508 GGCGCGGAGGGGGACCCCGCCGG - Intronic
1077081575 11:726791-726813 GGCGGGGGAGAGGAGGGCGCAGG - Intronic
1077161259 11:1113653-1113675 TGCGAGGAAGAGGAGGGCGCTGG - Intergenic
1077483158 11:2825995-2826017 GGCGGGGAGGACGAGGCCTCGGG - Intronic
1078216330 11:9314741-9314763 CGCGGGAAAGAGGTGGCCGCCGG + Exonic
1078930206 11:15906652-15906674 GGCAGGGAAGAGCACTCCGAGGG + Intergenic
1082785325 11:57313447-57313469 GGCGGGGAGGAGGAGGCCAAGGG - Exonic
1083207470 11:61161327-61161349 GGCGGGGCAGAGGACGACGGTGG - Intronic
1083332750 11:61906517-61906539 GGCGGGGCAGAGGGTGCTGCTGG + Exonic
1083812338 11:65112760-65112782 GGCGAGGGAAAGGACGCCCCGGG + Intronic
1084575164 11:69984517-69984539 GGCGGGGAAGGAGACCCGGCAGG + Intergenic
1084575306 11:69985138-69985160 GGCGGGGAAGAGGAAGGGTCGGG + Intergenic
1085322584 11:75583829-75583851 GGTGGGGAAGGGGACGCCGCGGG + Intergenic
1089489097 11:118870595-118870617 GGTGGGGAGGAGAAAGCCGCAGG - Intergenic
1089533991 11:119149627-119149649 GGCGGGGGAGAAGAGGCAGCCGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089895861 11:121929312-121929334 GGAGGGGAGGAGGAAGGCGCTGG + Intergenic
1091097734 11:132839998-132840020 GGCGGGGAGGAGAAAGCCCCTGG + Intronic
1091287029 11:134413171-134413193 GGCTGTGAAGAGGACACAGCGGG - Intergenic
1092261221 12:6954186-6954208 GGCGGGGAAGACAACCCCACTGG - Intronic
1095465184 12:42482846-42482868 GGCGGGGATGGGGACGACCCAGG - Intronic
1096240201 12:49955764-49955786 GGCGGGGAGGAGGCTGCCGGAGG + Exonic
1101931846 12:109021070-109021092 GGCGGAGAAGAGGAGGCGGAGGG + Intronic
1102101508 12:110281733-110281755 GGCGGAGGCGAGGAGGCCGCGGG + Exonic
1102561030 12:113762497-113762519 GGCGGGGGAGGGGGCACCGCTGG - Intergenic
1104602362 12:130162336-130162358 GGCGGGGAGGAGGCTGCCCCGGG + Intergenic
1105725758 13:23160456-23160478 GGCGGGGAAGTGGGCGCCCGCGG + Intergenic
1105943417 13:25170715-25170737 GCCCGGGGAGAGGACGCCGCGGG - Exonic
1106559015 13:30833001-30833023 TGCGGGGACAGGGACGCCGCGGG - Intergenic
1109061709 13:57629980-57630002 GGCGGAGAAGAGGATGGCGGGGG - Intergenic
1112506611 13:99979999-99980021 GGGGCGGACGGGGACGCCGCGGG + Intergenic
1113928258 13:113952886-113952908 GGCGGGGCAGAGGCAGCCCCCGG + Intergenic
1114484939 14:23056838-23056860 GGCGGGGGGGAGGACCCCTCAGG + Intronic
1115770105 14:36658718-36658740 CGCCGGGAAGGGGGCGCCGCAGG + Intronic
1117077251 14:52116977-52116999 GGTGGGAAAGAGGAGGCTGCTGG - Intergenic
1117675646 14:58152330-58152352 GGCGGGGAAGTGGGCGCAGGGGG - Intronic
1119520583 14:75281428-75281450 GGCAGGGAAGGGGAGGCAGCCGG + Exonic
1123042491 14:105496103-105496125 GGCAGGGAAGTGGAGACCGCAGG + Intronic
1123396523 15:19943591-19943613 GGCGGGTAAGAAGCCGCGGCAGG - Intergenic
1128342274 15:66830885-66830907 GGCGGGGCAGAGGAGGCTCCAGG - Intergenic
1128564713 15:68693280-68693302 GGTGGGGAAGAGGTCACAGCAGG + Intronic
1128582403 15:68818963-68818985 GGCGGGGAGGGGGCGGCCGCGGG - Intronic
1128776972 15:70328114-70328136 GGGGGGGAAGAGGACGCACTTGG - Intergenic
1129716821 15:77857196-77857218 GGCAGGGACGAGGAGGCAGCTGG - Intergenic
1130224422 15:82046337-82046359 GGCCGGGAGGAGGACGGGGCGGG - Intergenic
1130517185 15:84634216-84634238 GGCGGGGACGCGGCCGCCGCGGG - Intergenic
1131061624 15:89408168-89408190 GGCGGCGAGGAGGAGGCCGTTGG + Intergenic
1132582260 16:690278-690300 CGCGGGGGAGCGGACGCTGCGGG + Exonic
1132983848 16:2753202-2753224 GGCGGGGAAGGGGCGGCGGCGGG + Intronic
1133271842 16:4614321-4614343 GGCCGGAAGGAGGACGCCCCAGG - Intronic
1134070270 16:11256084-11256106 GGCGGGGCGCGGGACGCCGCGGG + Exonic
1134746621 16:16593705-16593727 CGTGGGGAAGAGGAGGACGCCGG + Intergenic
1134998853 16:18759975-18759997 CGTGGGGAAGAGGAGGACGCCGG - Intergenic
1136267930 16:29131857-29131879 GCCGGGGAAGAGGAAGGGGCTGG - Intergenic
1137655377 16:50154018-50154040 TGCGGGGACGAGGACGCCGAGGG - Exonic
1138605873 16:58088380-58088402 GGTGGGGAGGAGGAGGCCCCAGG + Intergenic
1139534414 16:67562687-67562709 GGCGGCGGAGCGGGCGCCGCGGG + Exonic
1141420788 16:83914266-83914288 GGCGAGGAGGGGGACGCTGCGGG - Intronic
1141646602 16:85371086-85371108 GGAGGAGAAGAGGACGCCTCCGG - Intergenic
1142071237 16:88092195-88092217 GCCGGGGAAGAGGAAGGAGCTGG - Intronic
1142090407 16:88206868-88206890 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142090420 16:88206894-88206916 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142090492 16:88207044-88207066 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142108400 16:88318408-88318430 GCTGGGGCAGAGGACACCGCTGG - Intergenic
1203123051 16_KI270728v1_random:1555434-1555456 GGCGGAGAAGCGGACAGCGCGGG - Intergenic
1203123060 16_KI270728v1_random:1555478-1555500 GGCGGAGAAGCGGACAGCGCGGG - Intergenic
1142559861 17:803476-803498 GGACGGGAAGAGGAAGCAGCAGG + Intronic
1142581965 17:948821-948843 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1142581980 17:948859-948881 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1142582066 17:949066-949088 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1142582110 17:949180-949202 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1142582138 17:949256-949278 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1142582166 17:949332-949354 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1142582236 17:949522-949544 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1142582257 17:949579-949601 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1142582272 17:949617-949639 GGGGGAGAGGAGGAGGCCGCGGG - Intronic
1143036744 17:4003944-4003966 GGCGGGGAGGAGGAGGAAGCGGG + Intergenic
1143481180 17:7228074-7228096 GCAGGGGAAGAGGAGGCCTCAGG + Intronic
1146062162 17:29613209-29613231 GGTGGGGGCCAGGACGCCGCGGG + Intronic
1146095913 17:29930112-29930134 GGGGAGGAGGAGGAGGCCGCGGG + Exonic
1146912502 17:36657828-36657850 CGCGGGGCGGAGGACGCAGCGGG + Intergenic
1147110463 17:38257429-38257451 GGCGAGGACGAGGGCGCGGCCGG + Intergenic
1147382191 17:40062721-40062743 GGCGGGGCAGAGGCGGCCGAGGG + Intronic
1147419544 17:40315540-40315562 GGAGGGGAAGAGGAGTCAGCTGG + Intronic
1147684312 17:42277452-42277474 GGAGGTGAAGAGAAGGCCGCTGG - Intergenic
1147994761 17:44354544-44354566 GGCGGCGAGGCGGGCGCCGCCGG - Exonic
1148206742 17:45784285-45784307 GGCCGGCAAGAGGCGGCCGCGGG + Intronic
1148419044 17:47531002-47531024 GGCGAGGACGAGGGCGCGGCCGG - Intronic
1149604580 17:57915818-57915840 GGCGGGGAGGAGGGGGCCTCAGG + Intronic
1150060570 17:62065326-62065348 GCGGTGGAAGAGGAGGCCGCCGG + Intergenic
1151233926 17:72704713-72704735 AGAGGGGAAGAGGACCCCCCAGG - Intronic
1151560259 17:74866090-74866112 GGCGGGGAGGAAGAGGCAGCGGG + Intronic
1152214381 17:79024049-79024071 GGCCGGGAGGAGGCGGCCGCTGG + Intronic
1152222120 17:79074755-79074777 GGCGGGGCCGAGGACGGGGCGGG - Intergenic
1152626573 17:81390446-81390468 GGAGGGGAAGAGGACGGCGAAGG - Intergenic
1152728760 17:81960037-81960059 GCGGGGGAACGGGACGCCGCGGG + Intronic
1153227310 18:2908702-2908724 GGCGGGGAAGAGGGCACTGAGGG - Intronic
1155096262 18:22559358-22559380 GGCGGGGAGGGGGACGTGGCTGG + Intergenic
1155153079 18:23136946-23136968 CGCGGGGAAGAGTGCGCCTCCGG - Intronic
1155972267 18:32093011-32093033 GGCGGGGAACGGGACCTCGCGGG - Intronic
1157571243 18:48713665-48713687 GCCAGGGAAGAGGAGGCCGGAGG + Intronic
1158457690 18:57622223-57622245 GGCGGTGGAGGGGACGCAGCGGG + Intergenic
1159241677 18:65750727-65750749 GGAGGGGAAGAGGGCGACGATGG - Intronic
1159636493 18:70810803-70810825 GACGGGTGAGAGGACGCAGCTGG - Intergenic
1160454881 18:78993094-78993116 GTTGGGGAAGATGACGCCGCTGG - Exonic
1160927863 19:1555735-1555757 GCCGGGGCCGAGGACGCCGAAGG + Exonic
1161150019 19:2702658-2702680 GGCGGGGCTGAGGCGGCCGCGGG - Exonic
1161353395 19:3805992-3806014 GGCGAGGGAGAGGAGGGCGCAGG - Exonic
1162582550 19:11539853-11539875 GGGGGGGAGGAGGGCGGCGCTGG - Intronic
1163029878 19:14537172-14537194 GGGGGGGAAGGGGAGGCCGAGGG + Intronic
1163609036 19:18291752-18291774 GGCGGCGGAGAGGACCCCGCAGG - Intergenic
1163636197 19:18438179-18438201 GGCGGGGAAGGGGGCGGGGCGGG - Exonic
1164574537 19:29397973-29397995 GGCGGGGATGGGGAAGCCCCAGG + Intergenic
1165204615 19:34172831-34172853 GGAGGGAACGAGGAGGCCGCGGG - Intronic
1165601622 19:37059205-37059227 GGCGTGGGAGAGGGGGCCGCGGG - Intronic
1165803124 19:38565154-38565176 GGCGCGGAGGAGGGCGCGGCGGG + Exonic
1166876526 19:45901343-45901365 GGCTGTGAAGAGGGGGCCGCAGG + Exonic
1168398271 19:56066905-56066927 CGAGGGGAAGGGGAGGCCGCTGG - Intergenic
1202683268 1_KI270712v1_random:29292-29314 GGCGGGGAACAAAAAGCCGCGGG - Intergenic
925200589 2:1965163-1965185 GGCAGGGAAGAGGAGGACCCAGG + Intronic
925200599 2:1965209-1965231 GGCAGGGAAGAGGAGGACCCAGG + Intronic
925200630 2:1965343-1965365 GGCAGGGAAGAGGAGGACCCAGG + Intronic
926066385 2:9843623-9843645 GGAGCGGCGGAGGACGCCGCGGG + Intronic
926716251 2:15926547-15926569 GGCTGTGAAGAGGACGGAGCTGG - Intergenic
928511761 2:32010069-32010091 GGCGGGGAAGAGGGCGCGGACGG - Intronic
931440339 2:62285803-62285825 GGCGGGGAAGAGGAAGGGGAAGG + Intergenic
933044792 2:77521921-77521943 GGCAGGGAAAAGGAAGCCGTTGG + Intronic
935145109 2:100390294-100390316 GGAGGGGAAGAGCACACCCCTGG + Intergenic
937421059 2:121755717-121755739 GCCAAGGAAGTGGACGCCGCAGG - Exonic
938289950 2:130143799-130143821 GGGGCGGGAGAGGAGGCCGCGGG + Intronic
938466573 2:131529138-131529160 GGGGCGGGAGAGGAGGCCGCGGG - Intronic
938800592 2:134759870-134759892 GGCTGGGAAGAGGAGGCGGGAGG + Intergenic
942296728 2:174524668-174524690 GGAGGAGAAGGTGACGCCGCAGG - Intergenic
942540328 2:177008722-177008744 GGTGTGGAAGAGGACCCCACCGG - Intergenic
944131184 2:196349064-196349086 GGTGGAGAAGAGGGTGCCGCAGG - Intronic
945179277 2:207075480-207075502 GGCGGGGAAGGAGACGGGGCTGG + Exonic
946358839 2:219206859-219206881 GGCGGGGGAGAGGAAGGGGCGGG + Exonic
946898516 2:224349261-224349283 GGTGGGGAAGAGGTTGCCACTGG + Intergenic
947387228 2:229603632-229603654 GGTGGGGACGAGGAAGCTGCTGG + Intronic
947876144 2:233469476-233469498 GGCGGGGATGTGGAGGCCACAGG - Exonic
948072392 2:235138409-235138431 GGCAGGGATGAGGAGGCCCCAGG + Intergenic
1168765976 20:381701-381723 GGCGGTGCAGGGGACACCGCCGG + Intronic
1171115830 20:22524106-22524128 GGCTGGGAAGAGGACGGCACAGG - Intergenic
1171847122 20:30284027-30284049 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1172292034 20:33783752-33783774 GGGTGGGCAGATGACGCCGCAGG - Exonic
1172684839 20:36745881-36745903 GGCGGGGCAGAGGGCCCCGGGGG + Intronic
1173003383 20:39121670-39121692 GGAGGGGGAGAGGACCCCACTGG + Intergenic
1176220389 20:63966839-63966861 GTCGGGGGAGAGGAGGCCTCGGG - Intronic
1176547516 21:8208190-8208212 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176547664 21:8208614-8208636 GGCGGGGAAGGGGACGCCACGGG - Intergenic
1176555425 21:8252399-8252421 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176555561 21:8252820-8252842 GGCGGGGAAGGGGACGCCACGGG - Intergenic
1176566467 21:8391237-8391259 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176574343 21:8435424-8435446 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176574491 21:8435848-8435870 GGCGGGGAAGGGGACGCCACGGG - Intergenic
1176610955 21:8986716-8986738 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176611103 21:8987140-8987162 GGCGGGGAAGGGGACGCCACGGG - Intergenic
1176684493 21:9836775-9836797 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1179803958 21:43825757-43825779 GGCTAGGAAGAGGAGGCTGCAGG - Intergenic
1180599618 22:17007657-17007679 GGCGGGAAAGGGGACACAGCAGG - Intronic
1184236844 22:43187307-43187329 GGCTGGGAGGAGGACGGGGCGGG - Intergenic
1184241323 22:43212617-43212639 GGCGGGCAGGAGGGCACCGCAGG + Intronic
1184286459 22:43474469-43474491 GGCGGGCAGGAGGAAGCTGCTGG - Intronic
1184680920 22:46071729-46071751 GGCGGGGACGGCGGCGCCGCGGG + Intronic
1185270852 22:49928848-49928870 GCCAGGGAAGAGGACGCCCCAGG + Intergenic
1203252389 22_KI270733v1_random:124475-124497 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1203252538 22_KI270733v1_random:124899-124921 GGCGGGGAAGGGGACGCCACGGG - Intergenic
1203260446 22_KI270733v1_random:169561-169583 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1203260594 22_KI270733v1_random:169985-170007 GGCGGGGAAGGGGACGCCACGGG - Intergenic
950072621 3:10164851-10164873 GGCGGGGAAGTGGGCGGGGCGGG - Exonic
950573915 3:13819435-13819457 GGCGGGGAAGAGCACAGCACAGG + Intronic
950749454 3:15117285-15117307 AGCGGGGAAGAGGACCCTGGAGG - Intergenic
955059873 3:55485285-55485307 CGCGGGGAAGAAAAGGCCGCGGG + Intronic
955400389 3:58587086-58587108 GGCGGGCGAGGAGACGCCGCCGG + Intronic
959575397 3:107927898-107927920 GGCGGGGAAGAGGACGCCGCCGG + Intergenic
962201329 3:133403343-133403365 GGGGGGGAAGAGGCAGCTGCAGG - Intronic
962738691 3:138347954-138347976 CGGGGGGAAAATGACGCCGCTGG + Exonic
963040420 3:141066075-141066097 TGCGGGGAGGAGGCCGCTGCAGG - Exonic
963044887 3:141095107-141095129 GGTGGGGAAGAGGCCGAGGCAGG + Intronic
963253273 3:143120749-143120771 GCCCGGGAAGGGGACGCAGCGGG - Exonic
964627543 3:158773586-158773608 GGCTGGGAAGAGTCGGCCGCGGG - Intronic
966852786 3:184174983-184175005 GGCGTGGAGGAGGACGCTGCGGG + Intronic
968516590 4:1018116-1018138 GACGGGGAAGGGCAGGCCGCAGG + Intronic
968584210 4:1408482-1408504 GGCGGGGAAGAGGGAGATGCAGG - Intergenic
969617468 4:8262069-8262091 TGCCGGGAAGCGGACGCCTCGGG + Intergenic
970441135 4:16082493-16082515 GGCGGGGAAGCCGGCGCCCCAGG - Intronic
970469317 4:16360936-16360958 GGAGAGGAAGAGTACGCCGAGGG - Intergenic
970472197 4:16389996-16390018 TGAGGGGAAGAGGACGAGGCAGG - Intergenic
972793918 4:42398014-42398036 GGCCGGGAGCAGGACGCAGCTGG - Exonic
973775029 4:54234094-54234116 AGCCGGGAAGACGACGCTGCTGG - Intronic
981475045 4:145179924-145179946 GGCGGGGACCAGGGCGGCGCGGG - Intronic
985489415 5:170747-170769 AGGGGGGAAGAGGATGCAGCTGG - Intronic
986199382 5:5567790-5567812 GGCTGGGCAGGGGATGCCGCAGG - Intergenic
995758993 5:115544435-115544457 GGCGGGAAGGAGGGCGCCGGGGG - Intronic
997198489 5:131995248-131995270 GGCCGAGAGGAGGATGCCGCAGG - Intronic
997647102 5:135488982-135489004 GCCGGGGAGGAGGCCGCCGAGGG + Intergenic
998130438 5:139648888-139648910 GGCGGGGAAGGGGAGGGGGCCGG - Intronic
999140521 5:149358293-149358315 GGCGCCGAAGGGGACGCGGCAGG + Intronic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1000296388 5:159916595-159916617 GGCGGGGAGGAGGGGGCGGCAGG - Intergenic
1001506546 5:172284198-172284220 GGCGGGGGAGGGGACGCAGGGGG + Intergenic
1001948085 5:175796951-175796973 GGCGAGGCAGAGGGCGCCTCGGG + Intronic
1002305308 5:178279544-178279566 GGCTGGGAAGACGAGGCCTCAGG + Intronic
1002349976 5:178576932-178576954 AGCGGGGAAGACGTCTCCGCGGG - Intronic
1003290871 6:4776900-4776922 GGCGGGGGAGGGGACGCGGCGGG - Intronic
1003604051 6:7542944-7542966 GGGGTGGGAGAGGACGACGCTGG + Intronic
1004282161 6:14289488-14289510 GGCGGGGAAGATCACACCCCAGG + Intergenic
1005928963 6:30466599-30466621 GGCGGGGTAGAGGTAGCGGCGGG - Intergenic
1007431781 6:41780835-41780857 GGAGGGGACCAGGACTCCGCTGG - Intronic
1008520930 6:52362100-52362122 GGCCGGGAGGAGGAGACCGCCGG - Intronic
1010402974 6:75468114-75468136 GGAGGGGATGAGGATGCCCCTGG - Intronic
1012062969 6:94511491-94511513 GGCGGGGAAGCGGGGGCCGGGGG - Intergenic
1013155670 6:107489840-107489862 GGCGGGGAGGTGGCGGCCGCGGG + Intergenic
1013207422 6:107957805-107957827 GCCGGGCAAGCGGGCGCCGCAGG + Intronic
1016033770 6:139364125-139364147 GGCGGGGAACAGCACACCCCGGG + Intergenic
1017021368 6:150142986-150143008 GGCGGGGAGGACGACGGGGCGGG - Intergenic
1018273321 6:162103833-162103855 GGTGAGGAAGAGGAGGCAGCTGG - Intronic
1018996921 6:168717110-168717132 GGCGGGGAAGTGGAGGCTGTGGG + Intergenic
1019112048 6:169724373-169724395 GGCGGGGCTGAGGCGGCCGCGGG - Intronic
1019112071 6:169724444-169724466 GGCGGGGCTGAGGCGGCCGCGGG - Intronic
1019437005 7:1027736-1027758 GCCGGGGTAGAGGACCCCGTCGG - Intronic
1019730438 7:2626842-2626864 GGCCGGGAAGAGAAGGCTGCGGG - Intergenic
1019882003 7:3869571-3869593 TGCTGGGAAGAGGACGCAGCGGG - Intronic
1023850133 7:44145840-44145862 CGAGGGAAAGAGGCCGCCGCTGG - Intronic
1023861866 7:44221463-44221485 GCCGGGGAGGAGGAAGCAGCAGG + Intronic
1024359561 7:48454557-48454579 TGCGGGGAAGTGGAAGGCGCCGG + Intronic
1024511408 7:50207509-50207531 GCAGGGGAAGAGGAAGGCGCTGG + Intergenic
1025481683 7:60991909-60991931 GGCGGGGAAAAAGCCGCGGCCGG - Intergenic
1026736819 7:72954326-72954348 GGCGGGGAAGTGAACCCCGACGG - Intergenic
1027106915 7:75410737-75410759 GGCGGGGAAGTGAACCCCGACGG + Intronic
1028081298 7:86580363-86580385 GGCGGGGAACATCACGCCCCAGG + Intergenic
1028796513 7:94908643-94908665 GGCGGGGGAGATGGGGCCGCCGG - Intronic
1029483595 7:100826802-100826824 GGCGGGGAAGAGGCGCCCGACGG - Intronic
1029736504 7:102468474-102468496 GGCTGGGAGGAGGAGGCTGCAGG + Intronic
1032396392 7:131592981-131593003 GGAGGGGAGGAGGGCGCCGGAGG + Intergenic
1035331661 7:158099823-158099845 GGGGAGGAAGAGGAGGCAGCCGG - Intronic
1036432331 8:8702392-8702414 GGCCGGGATGCGGACGCCGGTGG + Exonic
1037886606 8:22599257-22599279 GGCGAGGAAGAGGAGGGCGAGGG - Intronic
1049239359 8:141529078-141529100 GGCAGGGAGGAGGACGCAGCAGG - Intergenic
1049781117 8:144429376-144429398 CGCGGGCACCAGGACGCCGCCGG - Intronic
1052353898 9:27484747-27484769 GGCAGGGTAGAGGAGGCCGGGGG - Intronic
1053312276 9:37027365-37027387 GGCGAGGAAGAGTCCGTCGCTGG - Intronic
1053784351 9:41643808-41643830 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054160127 9:61667643-61667665 GGCGTGGGAGAGGGCGTCGCGGG - Intergenic
1054160659 9:61670370-61670392 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1054160947 9:61671779-61671801 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1054172306 9:61853941-61853963 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054172797 9:61856410-61856432 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054173086 9:61857781-61857803 GGCGTGGGAGAGGGGGCCGCAGG - Intergenic
1054447644 9:65385413-65385435 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054447937 9:65386823-65386845 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054664456 9:67723000-67723022 GGCGTGGGAGAGGGGGCCGCAGG + Intergenic
1054664743 9:67724391-67724413 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1054665231 9:67726864-67726886 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1057198249 9:93126979-93127001 GGAGGGGGAGAGGAGGCCGGGGG - Intronic
1057592406 9:96383700-96383722 GCCGGGGAAGAGGGCGCGGCAGG + Intronic
1058455262 9:105132586-105132608 GGCGGGGAAGAGGAGGTAGGAGG - Intergenic
1058715403 9:107718210-107718232 AGCGGGGAACAGCACGGCGCTGG - Intergenic
1058812327 9:108652906-108652928 GCAGGGGAAGAGGAGGCCGATGG + Intergenic
1060849197 9:126860687-126860709 GGCGGCGGAGGGGGCGCCGCGGG + Intronic
1061128177 9:128689682-128689704 GGCGGCGAAGATGGCGGCGCGGG - Intronic
1061136923 9:128740050-128740072 GATGTGGGAGAGGACGCCGCAGG + Exonic
1061398387 9:130355563-130355585 GGCGGGTAAGGGGACACCCCGGG - Intronic
1061675619 9:132214063-132214085 GGCAGGGAGGAGGAGGCCCCAGG - Intronic
1061840653 9:133356796-133356818 GGCAGGGGAGAGGGCGCGGCGGG + Intronic
1061883656 9:133580096-133580118 GGCGGGGAAGGGGACAGGGCAGG - Intronic
1062162795 9:135088975-135088997 CGCGGGGAAGGGGCCGCTGCCGG + Intronic
1203468794 Un_GL000220v1:107626-107648 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1203468942 Un_GL000220v1:108050-108072 GGCGGGGAAGGGGACGCCACGGG - Intergenic
1203476615 Un_GL000220v1:151598-151620 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1203476763 Un_GL000220v1:152022-152044 GGCGGGGAAGGGGACGCCACGGG - Intergenic
1185720022 X:2373903-2373925 GTGGGGGAAGAGGAAGCCACAGG + Intronic
1195884567 X:109625248-109625270 GCCTGGGAAGAGGCGGCCGCGGG - Intronic
1198376960 X:136050016-136050038 GGCGAGGGAGAGGATGCTGCGGG - Intergenic