ID: 959575633

View in Genome Browser
Species Human (GRCh38)
Location 3:107929949-107929971
Sequence CTGAGTTGCAATGAGTAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959575629_959575633 29 Left 959575629 3:107929897-107929919 CCATGTCCTTATGGAGTCTGGCA No data
Right 959575633 3:107929949-107929971 CTGAGTTGCAATGAGTAAATGGG No data
959575630_959575633 23 Left 959575630 3:107929903-107929925 CCTTATGGAGTCTGGCACATTAC No data
Right 959575633 3:107929949-107929971 CTGAGTTGCAATGAGTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959575633 Original CRISPR CTGAGTTGCAATGAGTAAAT GGG Intergenic
No off target data available for this crispr