ID: 959575652

View in Genome Browser
Species Human (GRCh38)
Location 3:107930174-107930196
Sequence ATGTATAAGCAGAAGCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959575647_959575652 6 Left 959575647 3:107930145-107930167 CCATTATTTTATTTGATCTCCAA No data
Right 959575652 3:107930174-107930196 ATGTATAAGCAGAAGCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959575652 Original CRISPR ATGTATAAGCAGAAGCTCAG GGG Intergenic
No off target data available for this crispr