ID: 959577212

View in Genome Browser
Species Human (GRCh38)
Location 3:107947343-107947365
Sequence ACTCTAATCTTCTGTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959577212_959577217 0 Left 959577212 3:107947343-107947365 CCCATGTCACAGAAGATTAGAGT No data
Right 959577217 3:107947366-107947388 TAGGCAGTCTAAGACTAGTGGGG No data
959577212_959577215 -2 Left 959577212 3:107947343-107947365 CCCATGTCACAGAAGATTAGAGT No data
Right 959577215 3:107947364-107947386 GTTAGGCAGTCTAAGACTAGTGG No data
959577212_959577216 -1 Left 959577212 3:107947343-107947365 CCCATGTCACAGAAGATTAGAGT No data
Right 959577216 3:107947365-107947387 TTAGGCAGTCTAAGACTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959577212 Original CRISPR ACTCTAATCTTCTGTGACAT GGG (reversed) Intergenic
No off target data available for this crispr