ID: 959577233

View in Genome Browser
Species Human (GRCh38)
Location 3:107947609-107947631
Sequence TGATGAAAATGAGATTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959577233_959577242 14 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577242 3:107947646-107947668 GGGTCATATGGTCATTGCTGGGG No data
959577233_959577236 -7 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577236 3:107947625-107947647 TTCATCACTTTGGCCAAAACTGG No data
959577233_959577238 2 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577238 3:107947634-107947656 TTGGCCAAAACTGGGTCATATGG No data
959577233_959577243 15 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577243 3:107947647-107947669 GGTCATATGGTCATTGCTGGGGG No data
959577233_959577237 -6 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577237 3:107947626-107947648 TCATCACTTTGGCCAAAACTGGG No data
959577233_959577244 20 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577244 3:107947652-107947674 TATGGTCATTGCTGGGGGTCTGG No data
959577233_959577240 12 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577240 3:107947644-107947666 CTGGGTCATATGGTCATTGCTGG No data
959577233_959577241 13 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577241 3:107947645-107947667 TGGGTCATATGGTCATTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959577233 Original CRISPR TGATGAAAATGAGATTTACT GGG (reversed) Intergenic