ID: 959577243

View in Genome Browser
Species Human (GRCh38)
Location 3:107947647-107947669
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959577234_959577243 14 Left 959577234 3:107947610-107947632 CCAGTAAATCTCATTTTCATCAC No data
Right 959577243 3:107947647-107947669 GGTCATATGGTCATTGCTGGGGG No data
959577233_959577243 15 Left 959577233 3:107947609-107947631 CCCAGTAAATCTCATTTTCATCA No data
Right 959577243 3:107947647-107947669 GGTCATATGGTCATTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type