ID: 959577711

View in Genome Browser
Species Human (GRCh38)
Location 3:107952234-107952256
Sequence TACACATGAATGTTAGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959577711_959577718 28 Left 959577711 3:107952234-107952256 CCTGGTCCTAACATTCATGTGTA No data
Right 959577718 3:107952285-107952307 AATTTAGAAGAAGAATAAGGAGG No data
959577711_959577719 29 Left 959577711 3:107952234-107952256 CCTGGTCCTAACATTCATGTGTA No data
Right 959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG No data
959577711_959577714 -7 Left 959577711 3:107952234-107952256 CCTGGTCCTAACATTCATGTGTA No data
Right 959577714 3:107952250-107952272 ATGTGTAAGAGAAAACGGCCAGG No data
959577711_959577715 4 Left 959577711 3:107952234-107952256 CCTGGTCCTAACATTCATGTGTA No data
Right 959577715 3:107952261-107952283 AAAACGGCCAGGAATAATCAAGG No data
959577711_959577717 25 Left 959577711 3:107952234-107952256 CCTGGTCCTAACATTCATGTGTA No data
Right 959577717 3:107952282-107952304 GGAAATTTAGAAGAAGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959577711 Original CRISPR TACACATGAATGTTAGGACC AGG (reversed) Intergenic
No off target data available for this crispr