ID: 959577712

View in Genome Browser
Species Human (GRCh38)
Location 3:107952240-107952262
Sequence TTCTCTTACACATGAATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959577712_959577719 23 Left 959577712 3:107952240-107952262 CCTAACATTCATGTGTAAGAGAA No data
Right 959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG No data
959577712_959577717 19 Left 959577712 3:107952240-107952262 CCTAACATTCATGTGTAAGAGAA No data
Right 959577717 3:107952282-107952304 GGAAATTTAGAAGAAGAATAAGG No data
959577712_959577718 22 Left 959577712 3:107952240-107952262 CCTAACATTCATGTGTAAGAGAA No data
Right 959577718 3:107952285-107952307 AATTTAGAAGAAGAATAAGGAGG No data
959577712_959577715 -2 Left 959577712 3:107952240-107952262 CCTAACATTCATGTGTAAGAGAA No data
Right 959577715 3:107952261-107952283 AAAACGGCCAGGAATAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959577712 Original CRISPR TTCTCTTACACATGAATGTT AGG (reversed) Intergenic
No off target data available for this crispr