ID: 959577719

View in Genome Browser
Species Human (GRCh38)
Location 3:107952286-107952308
Sequence ATTTAGAAGAAGAATAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959577711_959577719 29 Left 959577711 3:107952234-107952256 CCTGGTCCTAACATTCATGTGTA No data
Right 959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG No data
959577712_959577719 23 Left 959577712 3:107952240-107952262 CCTAACATTCATGTGTAAGAGAA No data
Right 959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG No data
959577716_959577719 -5 Left 959577716 3:107952268-107952290 CCAGGAATAATCAAGGAAATTTA No data
Right 959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959577719 Original CRISPR ATTTAGAAGAAGAATAAGGA GGG Intergenic
No off target data available for this crispr