ID: 959579184

View in Genome Browser
Species Human (GRCh38)
Location 3:107966921-107966943
Sequence TCAGGGCCACAGTAAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959579184_959579191 11 Left 959579184 3:107966921-107966943 CCCTGCTCTTACTGTGGCCCTGA No data
Right 959579191 3:107966955-107966977 GTCCTGAGGCCCTCGGCTCAAGG No data
959579184_959579195 24 Left 959579184 3:107966921-107966943 CCCTGCTCTTACTGTGGCCCTGA No data
Right 959579195 3:107966968-107966990 CGGCTCAAGGCCCACAACACCGG No data
959579184_959579188 -3 Left 959579184 3:107966921-107966943 CCCTGCTCTTACTGTGGCCCTGA No data
Right 959579188 3:107966941-107966963 TGAGCCTCATCACAGTCCTGAGG No data
959579184_959579190 4 Left 959579184 3:107966921-107966943 CCCTGCTCTTACTGTGGCCCTGA No data
Right 959579190 3:107966948-107966970 CATCACAGTCCTGAGGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959579184 Original CRISPR TCAGGGCCACAGTAAGAGCA GGG (reversed) Intergenic
No off target data available for this crispr