ID: 959580340

View in Genome Browser
Species Human (GRCh38)
Location 3:107976866-107976888
Sequence CAGTTTGAGCAGAGGGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959580340_959580352 17 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580352 3:107976906-107976928 AGTGTGAGCCACGCAGGGACAGG No data
959580340_959580357 30 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580357 3:107976919-107976941 CAGGGACAGGGGCCTGGCAGAGG No data
959580340_959580355 24 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580355 3:107976913-107976935 GCCACGCAGGGACAGGGGCCTGG No data
959580340_959580353 18 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580353 3:107976907-107976929 GTGTGAGCCACGCAGGGACAGGG No data
959580340_959580349 -6 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580349 3:107976883-107976905 AAACTGGGTGGTGGCAGGAAGGG No data
959580340_959580348 -7 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580348 3:107976882-107976904 CAAACTGGGTGGTGGCAGGAAGG No data
959580340_959580350 11 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580350 3:107976900-107976922 GAAGGGAGTGTGAGCCACGCAGG No data
959580340_959580354 19 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580354 3:107976908-107976930 TGTGAGCCACGCAGGGACAGGGG No data
959580340_959580351 12 Left 959580340 3:107976866-107976888 CCAAGGGCCCTCTGCTCAAACTG No data
Right 959580351 3:107976901-107976923 AAGGGAGTGTGAGCCACGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959580340 Original CRISPR CAGTTTGAGCAGAGGGCCCT TGG (reversed) Intergenic
No off target data available for this crispr