ID: 959581086

View in Genome Browser
Species Human (GRCh38)
Location 3:107983341-107983363
Sequence CTGGGACCAAAGATGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959581086_959581092 12 Left 959581086 3:107983341-107983363 CCTAATTCCATCTTTGGTCCCAG No data
Right 959581092 3:107983376-107983398 GCATGTCACACAATTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959581086 Original CRISPR CTGGGACCAAAGATGGAATT AGG (reversed) Intergenic
No off target data available for this crispr