ID: 959583151

View in Genome Browser
Species Human (GRCh38)
Location 3:108002394-108002416
Sequence GTGACTCCAGCATTCCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959583144_959583151 26 Left 959583144 3:108002345-108002367 CCTCCAGAGGCTCTCGGGGAGAA No data
Right 959583151 3:108002394-108002416 GTGACTCCAGCATTCCTTGGAGG No data
959583145_959583151 23 Left 959583145 3:108002348-108002370 CCAGAGGCTCTCGGGGAGAATCC No data
Right 959583151 3:108002394-108002416 GTGACTCCAGCATTCCTTGGAGG No data
959583143_959583151 27 Left 959583143 3:108002344-108002366 CCCTCCAGAGGCTCTCGGGGAGA No data
Right 959583151 3:108002394-108002416 GTGACTCCAGCATTCCTTGGAGG No data
959583146_959583151 2 Left 959583146 3:108002369-108002391 CCTGCCTTGTCTCTTCCAGCTTC No data
Right 959583151 3:108002394-108002416 GTGACTCCAGCATTCCTTGGAGG No data
959583148_959583151 -2 Left 959583148 3:108002373-108002395 CCTTGTCTCTTCCAGCTTCTGGT 0: 16
1: 154
2: 512
3: 893
4: 1704
Right 959583151 3:108002394-108002416 GTGACTCCAGCATTCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959583151 Original CRISPR GTGACTCCAGCATTCCTTGG AGG Intergenic
No off target data available for this crispr