ID: 959591894

View in Genome Browser
Species Human (GRCh38)
Location 3:108090917-108090939
Sequence CGGCGGCGGCGACCCCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 410}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959591894_959591905 22 Left 959591894 3:108090917-108090939 CCGCCGCGGGGTCGCCGCCGCCG 0: 1
1: 1
2: 6
3: 79
4: 410
Right 959591905 3:108090962-108090984 CCGCCGCCGCCGTTACAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 107
959591894_959591903 18 Left 959591894 3:108090917-108090939 CCGCCGCGGGGTCGCCGCCGCCG 0: 1
1: 1
2: 6
3: 79
4: 410
Right 959591903 3:108090958-108090980 GCAGCCGCCGCCGCCGTTACAGG 0: 1
1: 0
2: 4
3: 58
4: 295
959591894_959591898 -9 Left 959591894 3:108090917-108090939 CCGCCGCGGGGTCGCCGCCGCCG 0: 1
1: 1
2: 6
3: 79
4: 410
Right 959591898 3:108090931-108090953 CCGCCGCCGCCGCAGGTGTCCGG 0: 1
1: 0
2: 2
3: 39
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959591894 Original CRISPR CGGCGGCGGCGACCCCGCGG CGG (reversed) Exonic