ID: 959595085

View in Genome Browser
Species Human (GRCh38)
Location 3:108120991-108121013
Sequence GAGCATTCACAGTGATTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959595085_959595087 0 Left 959595085 3:108120991-108121013 CCTAAGAATCACTGTGAATGCTC No data
Right 959595087 3:108121014-108121036 TGGACAAATTGCTGCTGCGCTGG No data
959595085_959595088 1 Left 959595085 3:108120991-108121013 CCTAAGAATCACTGTGAATGCTC No data
Right 959595088 3:108121015-108121037 GGACAAATTGCTGCTGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959595085 Original CRISPR GAGCATTCACAGTGATTCTT AGG (reversed) Intergenic