ID: 959596284

View in Genome Browser
Species Human (GRCh38)
Location 3:108132380-108132402
Sequence CCATTTCCACCATGCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959596279_959596284 -4 Left 959596279 3:108132361-108132383 CCTTTCTGTGACGCATGCCCCAT No data
Right 959596284 3:108132380-108132402 CCATTTCCACCATGCCATGTGGG No data
959596278_959596284 11 Left 959596278 3:108132346-108132368 CCTATAAAATGTTATCCTTTCTG No data
Right 959596284 3:108132380-108132402 CCATTTCCACCATGCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959596284 Original CRISPR CCATTTCCACCATGCCATGT GGG Intergenic
No off target data available for this crispr