ID: 959597918

View in Genome Browser
Species Human (GRCh38)
Location 3:108147851-108147873
Sequence ATATACAAAGGGCTGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959597918_959597922 -8 Left 959597918 3:108147851-108147873 CCCTGGCACAGCCCTTTGTATAT No data
Right 959597922 3:108147866-108147888 TTGTATATCTTTATGTAAAGCGG No data
959597918_959597923 26 Left 959597918 3:108147851-108147873 CCCTGGCACAGCCCTTTGTATAT No data
Right 959597923 3:108147900-108147922 TATTAGCTTACACGATCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959597918 Original CRISPR ATATACAAAGGGCTGTGCCA GGG (reversed) Intergenic
No off target data available for this crispr