ID: 959611944

View in Genome Browser
Species Human (GRCh38)
Location 3:108305179-108305201
Sequence TAGAAAACAGAACCTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959611944 Original CRISPR TAGAAAACAGAACCTGAGCA AGG Intronic
900233428 1:1574497-1574519 GAGCAACCAGAACCGGAGCATGG - Exonic
900563438 1:3320019-3320041 TAGAAAACAGTGCCTGGGCCTGG + Intronic
901941564 1:12666156-12666178 GATAAATCAGAACCTGAGCCCGG - Exonic
902403935 1:16172975-16172997 AAGAAAAAGGAATCTGAGCATGG + Intergenic
902995934 1:20224901-20224923 TTCAAATCAGAACCTGAGAAGGG + Intergenic
903048935 1:20586790-20586812 TAGAAAAAATTACCTGGGCATGG + Intergenic
903346833 1:22690868-22690890 TAGAAAAATGAACATGAGCTTGG + Intergenic
903604325 1:24564207-24564229 TAGAAAAGAGAAGCTGAGAGAGG + Intronic
903689634 1:25163688-25163710 TCGAAATCAGGACATGAGCATGG - Intergenic
904548290 1:31294281-31294303 TAGCAAACGGATCCTCAGCATGG + Intronic
905301364 1:36988295-36988317 AAGAAAAGAAAACCTGAGCCTGG + Intronic
905568136 1:38982253-38982275 GAGAAAACAGAAACTCAGAAGGG - Intergenic
905661569 1:39730265-39730287 AAGAAAACAGAAACTGGGGAGGG - Intronic
906110819 1:43320895-43320917 TACAAAACATTAGCTGAGCATGG + Intronic
906179589 1:43806843-43806865 TACAAAACATTACCCGAGCATGG - Intronic
906256901 1:44357349-44357371 TAGAAAACAGAGCCTGGGCCGGG + Intergenic
907120328 1:52002659-52002681 GAGAAAACTGAAACTCAGCAAGG + Intergenic
907626174 1:56032361-56032383 TTGAAAACAGAATCTGATCTAGG - Intergenic
908144925 1:61230743-61230765 TAGAACACAGAGCTGGAGCAGGG - Intronic
908872390 1:68628578-68628600 TAGAAAAAAAAAGCTGGGCATGG + Intergenic
909517496 1:76528658-76528680 GAGAGAACAGTACCTGAACAAGG - Intronic
909953533 1:81749404-81749426 GAGAGAACAGAACATGAACAAGG - Intronic
910219870 1:84879465-84879487 TACAAAAAAGTAGCTGAGCATGG - Intronic
911228742 1:95336990-95337012 AAGAAAGCAGAGCCAGAGCAGGG - Intergenic
911445509 1:97987033-97987055 TTCAACACAGAATCTGAGCAGGG + Intergenic
912073335 1:105840911-105840933 TAGAAAACTGAACCTTTCCAAGG - Intergenic
912220588 1:107669998-107670020 TAGAAAACTGAACCTAGCCATGG - Intronic
912908348 1:113731381-113731403 TAAAAAACACCAGCTGAGCATGG + Intronic
915468182 1:156110138-156110160 TATAAAGCAGAGGCTGAGCATGG - Intronic
916738991 1:167631781-167631803 TAGAAAACACAACCAGGGCCAGG - Intronic
916796946 1:168176373-168176395 TAGAAAACAAAACCTAATCTTGG + Intergenic
919502796 1:198358597-198358619 AAGAAAACAGAAGCTTAGAAAGG - Intergenic
919698210 1:200601663-200601685 TAGAAAACAGAGTGTGAGTAAGG - Intronic
919928001 1:202202554-202202576 AAGAAAACAGAAGCTGAGAGAGG - Intronic
921114576 1:212076517-212076539 TATAATACAGAAACTGAGAAAGG + Intronic
921612813 1:217232482-217232504 TAGAAAACAGAAACTGGGACAGG - Intergenic
922442336 1:225666259-225666281 TAGAAACTTGAACTTGAGCATGG - Intergenic
922976261 1:229785923-229785945 TATAAAACAGAACTTGATCTAGG + Intergenic
923137563 1:231131869-231131891 CAGAAAACAAAGCCTGGGCATGG + Intergenic
1064718475 10:18202704-18202726 TCCAAAATAGAACCTGAGAATGG - Intronic
1065408738 10:25397810-25397832 TAAATAACAGAACCTAAGCAAGG - Intronic
1066254685 10:33667057-33667079 AAGAAAGCAGAACCAGAGGATGG + Intergenic
1066548332 10:36526206-36526228 AAGAAAAGAGAAGTTGAGCAGGG + Intergenic
1070900668 10:80026339-80026361 AAGAAAACAGAACCAGGGCTGGG + Intergenic
1070902883 10:80045944-80045966 AAGAAAACAGAACCAGGGCTGGG - Intergenic
1070997870 10:80802087-80802109 TGGAAGACAGAAAGTGAGCATGG - Intergenic
1071576269 10:86729058-86729080 TAGAAAACAGCACATCAGCTGGG - Intronic
1071762315 10:88622351-88622373 TAGAAAACAGAGCTTGAGACAGG - Intergenic
1072519849 10:96221772-96221794 TGGCAAAGAGAAGCTGAGCAGGG - Intronic
1072976066 10:100059642-100059664 TAGAAAACACCACCTGTGCACGG - Intronic
1073213501 10:101823345-101823367 TAGAAAATGGAAACTGGGCAAGG + Intergenic
1074093618 10:110287628-110287650 TAGAGAACAGATCATGAGAATGG - Intergenic
1074120594 10:110491321-110491343 TAGAAAACAGAAAGTGAGGAAGG + Intergenic
1074295663 10:112185441-112185463 TAGAAAAAATAAACTGAGCATGG + Intronic
1074345066 10:112677105-112677127 TAGACATGAGAACCTGTGCAGGG + Intronic
1074347022 10:112696642-112696664 AAGAAAACAGAATCTGACCAAGG - Intronic
1074463304 10:113658724-113658746 TAGAAAAAATTAGCTGAGCATGG + Intronic
1074535012 10:114322598-114322620 TGGAAAACAGAACAGGAGCTGGG - Intronic
1074945435 10:118276590-118276612 GAGACACCAAAACCTGAGCAAGG + Intergenic
1075414751 10:122254129-122254151 GTGAAAACAGAACCTGTCCATGG - Exonic
1075933807 10:126322697-126322719 AAGGAAACAAAGCCTGAGCAAGG + Intronic
1076527463 10:131121130-131121152 TCCAAGACAGAACATGAGCAGGG + Intronic
1076694819 10:132242408-132242430 TGGAAAACAGCACCTGAGGTTGG + Intronic
1078257714 11:9674194-9674216 CAGAAAACAGAATCTCAGCCAGG - Intronic
1078292387 11:10025753-10025775 TAGAAAACAGTAGCGGAGCATGG - Intronic
1079045324 11:17097185-17097207 CAGAAAAACGAAGCTGAGCAAGG + Exonic
1080614623 11:33935252-33935274 GAGAAAACAGAAGCTCAGAAAGG - Intergenic
1080652124 11:34231091-34231113 TGGAAAACAGAAAATGAGCTTGG + Intronic
1080958663 11:37131275-37131297 TAGAGAAAAGAACTTGTGCAGGG - Intergenic
1080982260 11:37423077-37423099 AAGAAAAGAGAACTTGTGCAGGG + Intergenic
1081338726 11:41901469-41901491 TAGAAAAAATAATGTGAGCAAGG - Intergenic
1081539687 11:44023205-44023227 TATAAAAAAGTAGCTGAGCATGG - Intergenic
1083101923 11:60317023-60317045 TAGAAAACAGGATCTGAGACAGG - Intergenic
1083101978 11:60317691-60317713 TAGAAAACAGAGCCTGAGACAGG - Intergenic
1084394046 11:68897198-68897220 GAGATAACAGGAACTGAGCACGG - Intronic
1085014645 11:73165309-73165331 GAGAAAGCAGAAGCTGAGCTAGG + Intergenic
1085043055 11:73338138-73338160 TAGGAAACAGGACCTGACCAGGG + Intronic
1085262013 11:75211514-75211536 GAGAAAACAGAAGATGAGTATGG + Intergenic
1085386166 11:76159578-76159600 TAGAAAACAGAGGCTCAGCAAGG - Intergenic
1086610842 11:88753877-88753899 AAGAAAAAAGAGCTTGAGCAGGG + Intronic
1087176855 11:95104290-95104312 TAGAAAACATTAGCTGGGCATGG + Intronic
1087882931 11:103440138-103440160 TAGAAATCAACACATGAGCAAGG - Intronic
1089222994 11:116890794-116890816 CAGAAAACAGAACTTGTTCAGGG + Intronic
1089399684 11:118157260-118157282 CAGAAAACAGAAACAGAGGAAGG - Intergenic
1089475447 11:118757017-118757039 TAGAAAATTGAACCTGAGGGAGG + Intronic
1089627875 11:119762900-119762922 GACAAAACAGGACATGAGCAAGG - Intergenic
1090983986 11:131749752-131749774 TAGAAAAAATTATCTGAGCATGG - Intronic
1091947380 12:4560630-4560652 TTGACAACAGAACCTGTGGATGG + Intergenic
1092724637 12:11473458-11473480 AAGAGAAGAGAACCTGTGCAGGG - Intronic
1093108067 12:15113325-15113347 AAGAAAACAAAACCAAAGCATGG + Intronic
1093211642 12:16315583-16315605 TAGAAAGCATTACCTCAGCACGG + Intergenic
1093800177 12:23363226-23363248 TAGGATACAGGGCCTGAGCAGGG + Intergenic
1094020800 12:25912099-25912121 TAGAAAAAATTAGCTGAGCATGG - Intergenic
1095759833 12:45818479-45818501 TACAAAAGAAAAACTGAGCAGGG - Intronic
1096405745 12:51342933-51342955 TAATAAACAAAACCTGGGCACGG - Intronic
1096773528 12:53950921-53950943 TAGAAAGCAGCACCTGGGGAAGG + Intergenic
1096894182 12:54803475-54803497 TTGAAAACAAAATCTGAGAATGG - Intergenic
1097729547 12:63112321-63112343 TAGCAAACACTACCTGAGCCAGG - Intergenic
1098762558 12:74443378-74443400 TCGAAAATATAAACTGAGCATGG + Intergenic
1099517468 12:83615224-83615246 AAGAAAACAGAAACTTAGGAGGG - Intergenic
1099837632 12:87927510-87927532 AAGAAAAGAGAACTTGTGCAGGG + Intergenic
1099901680 12:88718480-88718502 TAGAAAATAAAAACTGAGCAAGG - Intergenic
1100402023 12:94240184-94240206 TAGAAAGCAGAACATGAACTGGG - Intronic
1100928976 12:99584759-99584781 CAGGCAACAGAACATGAGCAGGG + Intronic
1101159273 12:101956738-101956760 TAGGAATCTGAAGCTGAGCAAGG + Intronic
1101301275 12:103485162-103485184 TAGAAAACTGAAACTGGGCCGGG - Intronic
1101923827 12:108954875-108954897 TAGAAAAAATTAGCTGAGCATGG + Intronic
1102141952 12:110622521-110622543 CAGAAAACAGGAGCTGAGCTGGG + Intronic
1102759605 12:115374237-115374259 CAGAAAACAGAAGCTGACCCAGG + Intergenic
1104583822 12:130031036-130031058 CAGAAAAAAGAATCTGAGGAGGG - Intergenic
1105343075 13:19546207-19546229 AAGAAAAAAAAACCTGTGCACGG + Intergenic
1106490823 13:30220163-30220185 TAGAAAACAAAACATGGGCTGGG + Intronic
1107996390 13:45865311-45865333 TAGAGAACAAAACCTGAACTTGG + Intergenic
1108373581 13:49793267-49793289 TATAAAACTGAAGCAGAGCATGG - Intergenic
1108975888 13:56442665-56442687 TAGAACACAGAAACTTAGGATGG - Intergenic
1109521561 13:63518593-63518615 TAGAAAACAAAGTCTGAGCTTGG + Intergenic
1109580504 13:64326258-64326280 TAGAATACAGAATCTGAGCCAGG + Intergenic
1109651504 13:65333386-65333408 TACAACACAGAATCTAAGCAAGG + Intergenic
1110477043 13:75928276-75928298 AAGAAAAGAGAACTTGTGCAGGG - Intergenic
1110822017 13:79927632-79927654 TAGAAAGTAGAAGCTGGGCATGG + Intergenic
1110866753 13:80405244-80405266 TGGAAAACAGAAAATAAGCAGGG - Intergenic
1112288267 13:98123168-98123190 TAGAAAGGAATACCTGAGCATGG - Intergenic
1112628583 13:101135552-101135574 TAAAAAAAAGTAGCTGAGCATGG - Intronic
1112941567 13:104868629-104868651 GAGAAAACTGAACCTCAGAAAGG - Intergenic
1113311383 13:109136603-109136625 TAGAAAACAGAAAATGAACAGGG - Intronic
1114357075 14:21922399-21922421 TAGAAAAAAATACGTGAGCAGGG - Intergenic
1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG + Intergenic
1117028933 14:51650741-51650763 AAGGAAACAGGACCTGAGAAAGG - Intronic
1117492028 14:56257950-56257972 AACAAAACAGTACCTGACCAAGG - Intronic
1117793510 14:59366332-59366354 GAGAAAACAGCAACTGAGTATGG - Intronic
1119244674 14:73093933-73093955 AAAAAAACAAAACCTGATCATGG - Intronic
1119460066 14:74794337-74794359 TAGAAAACTTAAGCTGGGCATGG - Intronic
1120076465 14:80164466-80164488 AAGAAAGCAGAACTTGAGCTGGG + Intergenic
1120217999 14:81701358-81701380 TAGAAAACAGCAGTTTAGCATGG + Intergenic
1120317301 14:82912043-82912065 TAGCAAACAGACCCTAAGCTGGG - Intergenic
1120906900 14:89628495-89628517 CAGTCAACAGAAGCTGAGCATGG - Intergenic
1120965030 14:90159342-90159364 TAGAAATCAGAAACGGAGCCAGG + Intronic
1121045863 14:90787024-90787046 TAGAATACAGCACCAGAGCTGGG - Intronic
1121927368 14:97940458-97940480 TGGTTAACAGAAGCTGAGCAGGG - Intronic
1123144769 14:106118243-106118265 TAGAAAGCAGATACTAAGCACGG + Intergenic
1124946780 15:34275251-34275273 TAGAAAATAGAATCAGAGAAGGG + Intronic
1125114338 15:36071792-36071814 TAGAAACCAAAATCTGGGCATGG - Intergenic
1125352384 15:38781366-38781388 TAGAAAAGAGATCCTCAGAATGG + Intergenic
1126317652 15:47387357-47387379 AAGAAAACAGAACATGAACTTGG + Intronic
1127439728 15:58994191-58994213 TATAAAAAATAACCTGAGCGTGG - Intronic
1128602913 15:69012807-69012829 TTGAAAGCAGAACTGGAGCAGGG - Intronic
1128846950 15:70907374-70907396 TCACATACAGAACCTGAGCAAGG - Intronic
1129086463 15:73097828-73097850 TAGAGACCAAAACCTGAGTATGG + Intronic
1129304879 15:74652732-74652754 TAGAAAACATTAGCTGGGCACGG - Intronic
1130888331 15:88112194-88112216 CAGAAACCAGAGGCTGAGCATGG - Intronic
1131302623 15:91212848-91212870 TTAAAAAGAGAAGCTGAGCACGG + Intronic
1132281825 15:100624133-100624155 TAGAAAACAGAGGCTGGGAAGGG + Intronic
1134491998 16:14702658-14702680 TAGAAATCAGAACCTTAGGAAGG - Intergenic
1134497379 16:14741780-14741802 TAGAAATCAGAACCTTAGGAAGG - Intronic
1134912972 16:18045113-18045135 TAGAAAACTGAAACTCAGAAGGG + Intergenic
1134970763 16:18528810-18528832 AAGAAAAAAAAAGCTGAGCATGG + Intronic
1135487529 16:22879206-22879228 CAGAAAACAGAGCCTGAGTTTGG - Intronic
1135502803 16:23011949-23011971 TAGAAAGGAGAAAGTGAGCAGGG - Intergenic
1135965580 16:27032381-27032403 AAAAAAAAAGAAGCTGAGCATGG - Intergenic
1136153215 16:28365552-28365574 TAGAAATCAGAACCCTAGGAAGG + Intergenic
1136209871 16:28749721-28749743 TAGAAATCAGAACCCTAGGAAGG - Intergenic
1136670825 16:31855337-31855359 TAGCAAACACAGCCTAAGCAAGG + Intergenic
1137766898 16:50984893-50984915 TAGGAAACAGGACCTGCGTAAGG + Intergenic
1137931721 16:52594781-52594803 AAAAAAACAGAGGCTGAGCAGGG - Intergenic
1138307736 16:55993490-55993512 TAGGAATCAGGATCTGAGCAGGG + Intergenic
1138617251 16:58179207-58179229 TAGAAAGGAGAGGCTGAGCATGG + Intronic
1139194909 16:64907431-64907453 TACAAAACATTAGCTGAGCATGG - Intergenic
1140612757 16:76621013-76621035 TAGAAAACACAAATTGAGCATGG - Intronic
1141264568 16:82484801-82484823 TAGAAAACTGAACGGGAGCCAGG - Intergenic
1141329189 16:83093177-83093199 GAGAAGACAGAAACTGAGTAGGG - Intronic
1143436907 17:6935717-6935739 TAGCAGGCAGAAACTGAGCAGGG + Intronic
1143789357 17:9281393-9281415 TAGAAAACAGAAGAAAAGCAGGG + Intronic
1144827367 17:18113458-18113480 AAGCAAACACAAGCTGAGCATGG + Intronic
1146476823 17:33169515-33169537 GAGAAAACAGAAGCTCAGAAAGG + Intronic
1148005613 17:44426446-44426468 TACAAAACATTAGCTGAGCATGG + Intronic
1148697570 17:49570366-49570388 AAGAAAGCAGGGCCTGAGCAGGG - Intergenic
1148813538 17:50310531-50310553 TAGGAAACAATACCTGAGTAAGG - Intergenic
1149355537 17:55835426-55835448 TAGAAATCAGAAAATGAGGAAGG - Intronic
1152330202 17:79668419-79668441 AAGAAAGGAGCACCTGAGCAGGG + Intergenic
1152938423 17:83153561-83153583 CAGAATCCAGAGCCTGAGCAGGG - Intergenic
1153558029 18:6337607-6337629 TAGAAAATAGTACCTAAGAAAGG + Intronic
1153704730 18:7733872-7733894 CAGAAAAGAGAACCTGCCCAGGG - Intronic
1153810730 18:8749594-8749616 AAGAAAGCAGAGCCTGAGCTTGG + Intronic
1155450422 18:25957625-25957647 TAGAGAACAGAAACTCAGGAAGG - Intergenic
1155799062 18:30077643-30077665 TAGATATCAGAAGCTGAGAATGG - Intergenic
1156047079 18:32889004-32889026 TAGAAAATGGAAGCTTAGCAGGG + Intergenic
1156309730 18:35910833-35910855 CAGGTAACAGAACCTGACCATGG - Intergenic
1156389719 18:36639072-36639094 TTGAAGAAAGACCCTGAGCAGGG + Intronic
1156989436 18:43389621-43389643 GAGAAAACAGAAAATGAGCAGGG + Intergenic
1157362440 18:47032268-47032290 TGGGTGACAGAACCTGAGCATGG - Intronic
1158230121 18:55245202-55245224 TAGAAAACAGAAGTTGAAAATGG - Intronic
1158795541 18:60841357-60841379 TAGAAAACAGAAGAAAAGCAGGG + Intergenic
1159365524 18:67461872-67461894 TAGAAAACAAAAAAAGAGCAGGG - Intergenic
1159382371 18:67677127-67677149 TAGAAAACACATACTGTGCAAGG + Intergenic
1161003668 19:1924061-1924083 CAGAAGACAGAAAATGAGCATGG - Intronic
1164022680 19:21322455-21322477 TAGAAAAAATAAGCTGGGCATGG - Intronic
1165413914 19:35679474-35679496 TACAAAAAAGTACCTGGGCATGG + Intergenic
1165668115 19:37651418-37651440 TACAAAAAATTACCTGAGCATGG + Intronic
925023528 2:589936-589958 TAGAAAAGAGCACCTGAGCTAGG + Intergenic
925340798 2:3134229-3134251 TAAAAAAGAAAACCTGACCAGGG + Intergenic
926078803 2:9966549-9966571 TAAAAAACAGAGACTGAGAAAGG - Intronic
928377051 2:30783882-30783904 TAGAAAGCAGAACATGAGGCTGG + Intronic
929498044 2:42463885-42463907 TTGAAAACAAAATCTGAGAAGGG - Intronic
930380048 2:50616600-50616622 TAGAATACAGAACCCTATCAAGG - Intronic
931226570 2:60336993-60337015 TGGAGAACAGAAACTTAGCAGGG + Intergenic
931262869 2:60635640-60635662 AAGAGAACATATCCTGAGCAAGG + Intergenic
932762023 2:74444183-74444205 CAGAACACAGAACTTGAGAAAGG + Intergenic
932798302 2:74716565-74716587 GAGAAAGCAGCACCTGAGTAGGG + Intergenic
932798390 2:74717480-74717502 GAGAAAGCAGCACCTGAGTAGGG + Intergenic
932833012 2:75008738-75008760 TTCCAAAAAGAACCTGAGCAAGG - Intergenic
934095127 2:88594895-88594917 TAAAAAAAAGAACCTGAGGCTGG + Intronic
935593330 2:104860884-104860906 TACAAAACAGATTATGAGCATGG - Intergenic
935717148 2:105949090-105949112 TAGAACACAAAGGCTGAGCAAGG + Intergenic
936687594 2:114846563-114846585 AAAAAAACAGAATCTGAGTATGG - Intronic
937200142 2:120197419-120197441 TAGCAAACTGAAGCTGAGCACGG + Intergenic
938724881 2:134098625-134098647 TAGAGAAAAGAGCCAGAGCAAGG + Intergenic
939067618 2:137503729-137503751 TAGAAAAGAGAAAGTGAGCCGGG + Intronic
939198609 2:139005197-139005219 TAGAAAACAGAACTTGTTTAGGG + Intergenic
939453910 2:142408813-142408835 TAGAAATCTGAACCTGAATATGG + Intergenic
939562237 2:143745838-143745860 GAGGAAACTGAAGCTGAGCAAGG + Intronic
940135496 2:150431228-150431250 TAAAAAACAGAACCTGAGGCAGG + Intergenic
940423613 2:153507567-153507589 TAAAAAACATCACCTGGGCATGG - Intergenic
941358134 2:164517179-164517201 TAGACAAGAGAACTTGTGCAGGG + Intronic
941584304 2:167337635-167337657 TAGAAAAAAGAAACTGCTCAAGG - Intergenic
941616400 2:167725549-167725571 TAGAAAACAGAAGCTAAGAAGGG + Intergenic
942883692 2:180895885-180895907 TAGTAACCAGAGCCTGAGAAGGG - Intergenic
942929320 2:181470717-181470739 AAGAAAAGAGAAGCTGGGCATGG + Intronic
942986996 2:182155241-182155263 TATAAAAAAGTACCTGGGCATGG - Intronic
943093134 2:183397234-183397256 AAGAAGACAGAACCTCAGAAAGG - Intergenic
944045864 2:195411264-195411286 GAGAAAATAGAAACTGAGAATGG + Intergenic
944320726 2:198339057-198339079 TGTAAAACAGAACCTAAGAATGG + Intronic
944910235 2:204303766-204303788 TAGTAAACATAATGTGAGCAAGG + Intergenic
944960845 2:204871516-204871538 TACAAAACATAACGTGAGAAGGG - Intronic
945204055 2:207312991-207313013 TAGAAAACAGAGCCTGAGGCAGG + Intergenic
945430457 2:209757343-209757365 TAGAAAACAAAAAAAGAGCAGGG + Intergenic
945772342 2:214059880-214059902 CAGATAACATAACCTGACCACGG - Intronic
947053912 2:226078686-226078708 CAAAAAACAGAATCTGATCAGGG - Intergenic
947228562 2:227863126-227863148 CAGAAAACCCAAGCTGAGCAAGG - Intergenic
947269609 2:228319177-228319199 TAGAAAAAATAAGCTGGGCATGG + Intergenic
947308302 2:228772650-228772672 GAGAAGTCAGAACCAGAGCAAGG - Intergenic
947616184 2:231558304-231558326 TAAAAAACATTACCTGAGCCGGG + Intergenic
947758234 2:232584801-232584823 TAGAATACAGAACAAGAGAATGG + Intergenic
947932738 2:233976999-233977021 AAGAAAAAAGAACCCAAGCAGGG + Intronic
1169333679 20:4737466-4737488 AAGAAAACAGAACATCATCAAGG + Intronic
1169431068 20:5536971-5536993 TAGAAAGCTGAATCTGAACAAGG - Intergenic
1170453978 20:16515306-16515328 TTAAAAACAGAAAATGAGCAGGG + Intronic
1170583327 20:17715289-17715311 GAGAAAACAGAACCAGCCCACGG - Intronic
1171147122 20:22794725-22794747 TAGAAAAGAGAAGCTGATTATGG + Intergenic
1172126138 20:32626454-32626476 GAGAAAACTGAAGCTGGGCAAGG + Intergenic
1172289223 20:33763636-33763658 TAGAAAACAGATTCTGAGCAGGG - Intronic
1172903617 20:38352462-38352484 AAAAAAACAGCAGCTGAGCACGG + Intronic
1173022100 20:39275195-39275217 TACAAAAGAGAACTTGAGCTGGG - Intergenic
1173226028 20:41162932-41162954 CAGGAAACAGAACCTGGTCAGGG - Intronic
1173553227 20:43947939-43947961 TGGAGAACAGAAGCTGAGCCAGG + Intronic
1174242162 20:49145739-49145761 AAGAAAAGAAAACCTGAGCCAGG + Intronic
1176335569 21:5594858-5594880 TAGAAAACAAACCCTTACCATGG + Intergenic
1176392188 21:6226090-6226112 TAGAAAACAAACCCTTACCATGG - Intergenic
1176469231 21:7090084-7090106 TAGAAAACAAACCCTTACCATGG + Intergenic
1176492792 21:7471862-7471884 TAGAAAACAAACCCTTACCATGG + Intergenic
1176507850 21:7666521-7666543 TAGAAAACAAACCCTTACCATGG - Intergenic
1176692917 21:9938994-9939016 TAGAAAACATTAGCTGGGCATGG - Intergenic
1177280327 21:18973631-18973653 TAGAAAACAGAAGAAAAGCAGGG + Intergenic
1177893017 21:26829022-26829044 TAGAACACAAAAACTGAGTAAGG + Intergenic
1178747208 21:35264589-35264611 GAGAAAACAGAAGCTCAGGAAGG - Intronic
1179558834 21:42199582-42199604 CAGAAAACAGGAAGTGAGCAGGG - Intergenic
1179666364 21:42915369-42915391 TAGAAAACATTAGCTGGGCATGG + Intergenic
1181170764 22:21008510-21008532 TAGAAAACAGAGGCTGAGGCTGG - Intergenic
1181840160 22:25650499-25650521 TAGAAAATAGAACCAGATCAGGG + Intronic
1181909145 22:26224349-26224371 TAGAGAACAGAAGCTGAGCCAGG - Intronic
1183280861 22:36931697-36931719 AAGAAAGCAGAAACTGGGCAGGG - Intronic
1183880883 22:40827793-40827815 TAGAAAAAAGTTGCTGAGCATGG - Intronic
1184136169 22:42551092-42551114 TTTAATACAGAACCTGGGCAAGG + Intergenic
1185074658 22:48676761-48676783 GAGAAACCAGGACTTGAGCAGGG - Intronic
949188164 3:1218534-1218556 TGGACATCAGGACCTGAGCAGGG + Intronic
949203197 3:1405925-1405947 TAGAAAAGAGACACTGAGCATGG - Intergenic
949416214 3:3817115-3817137 TACAAAACAGAAACTGTGAAAGG - Intronic
949560855 3:5201050-5201072 AAAAAAACAGAAGCTGGGCATGG - Intronic
949715575 3:6927135-6927157 TAGAAAAATGAAGCTGGGCATGG + Intronic
950050165 3:9982407-9982429 TACAAAAAATAACCCGAGCATGG - Intronic
951449721 3:22823325-22823347 TTTAAAACAGAAACTAAGCAAGG + Intergenic
952254295 3:31682216-31682238 TTGAAAACAGACCCTGGGCGGGG - Intronic
952596962 3:35029362-35029384 AAGAAAAGAGAACTTGTGCAGGG + Intergenic
953268501 3:41416673-41416695 TAGGAAACACAGCCTGAGTAAGG + Intronic
953475382 3:43201609-43201631 CAGAAAGCAGAAACTGAGCAAGG + Intergenic
954202347 3:49031282-49031304 TAGAAAACACAACATGAGGCTGG - Intronic
956194585 3:66639648-66639670 TTGAAAACAGAACTACAGCATGG - Intergenic
957692872 3:83595275-83595297 AAGAAAAAAGAACTTGTGCAGGG - Intergenic
959611944 3:108305179-108305201 TAGAAAACAGAACCTGAGCAAGG + Intronic
960267521 3:115637524-115637546 TAGAAAAGAGAAGCCAAGCATGG - Intronic
960596724 3:119414138-119414160 GAGAAGCCGGAACCTGAGCAGGG + Exonic
962133266 3:132705622-132705644 TTGAACACAGTACCTGAGGAAGG - Intronic
962590718 3:136887321-136887343 TAGAAAAAAAATGCTGAGCATGG - Intronic
962621232 3:137181786-137181808 CAAAAAGCAGACCCTGAGCAAGG - Intergenic
963473927 3:145779680-145779702 AAAAAAACTGAAACTGAGCAAGG + Intergenic
963813825 3:149808051-149808073 TAAAAAACAGAAAAAGAGCAGGG - Intronic
964824612 3:160811358-160811380 TAGAAAACACAATCCAAGCAAGG - Intronic
965673428 3:171170894-171170916 TAGAAAAAAGTAGCTGAGCATGG + Intronic
966203862 3:177386009-177386031 TAGAAAAAGAAATCTGAGCAAGG + Intergenic
966233772 3:177677637-177677659 TTGAAAACAGAAGCTGAGAGAGG + Intergenic
966303192 3:178501211-178501233 AAAAAAAAAGAACCTGACCATGG + Intronic
966326757 3:178765371-178765393 TATAAAACAGAAAATGAGCCAGG - Intronic
966505475 3:180696121-180696143 AAGAAAACTGAAGCTTAGCATGG + Intronic
966533409 3:181005040-181005062 TAGAAAAAATAGGCTGAGCACGG + Intergenic
968816330 4:2823661-2823683 TAGCAACCAGAACCAGAGCTGGG - Intronic
969939011 4:10711931-10711953 TATTCAACAGAACCTGAACATGG + Intergenic
970286426 4:14521697-14521719 GAGAAAACAGAAGCTCAGAAAGG + Intergenic
970569807 4:17368658-17368680 GAGAAAACTGATGCTGAGCAAGG + Intergenic
970897715 4:21122809-21122831 TAGAAACTAGAACTGGAGCAAGG - Intronic
971047796 4:22825292-22825314 AAGAAAACAGAAGCTAAGTATGG - Intergenic
971425102 4:26508133-26508155 TAAAAAACATTAGCTGAGCATGG - Intergenic
972180137 4:36454523-36454545 TAGAAGAAAGAATCTGAGAAAGG - Intergenic
972348727 4:38215569-38215591 AAGAAAACAGAAACTAAGGAGGG + Intergenic
975721192 4:77250196-77250218 TAGAAACCACAACTAGAGCATGG + Intronic
976331939 4:83842399-83842421 TGGATATCAGAGCCTGAGCAGGG - Intergenic
976500225 4:85779392-85779414 CAGACAAGAGAACCTGGGCAGGG + Intronic
976709865 4:88057722-88057744 AAGAAAACACAAGCTGGGCACGG - Intronic
977636159 4:99300793-99300815 CAGTAAACAGAACTTGAGAATGG + Intergenic
978555491 4:109975195-109975217 CAGAAAACAGAAACTGTGAAAGG + Intronic
978798915 4:112736165-112736187 TAAAAAACAGAACCAGGGCTGGG + Intergenic
979131955 4:117058266-117058288 TAGAAAATAGAAACAGAACATGG + Intergenic
979829910 4:125286314-125286336 TACAAAACATTAGCTGAGCATGG - Intergenic
980365517 4:131799194-131799216 TAGAAAACATTAGCTGGGCATGG - Intergenic
981022628 4:140045098-140045120 TAAAAAACAGAATCTGGGCCAGG + Intronic
981230931 4:142354661-142354683 TAGAAAACTGAAACTTAGCAAGG + Intronic
981698075 4:147578846-147578868 TAGAAAAAATTACCTGGGCACGG - Intergenic
982037469 4:151360274-151360296 GAGAAATCAGAGCCTTAGCAGGG + Intergenic
982429327 4:155304722-155304744 AAGATACCAGAACCTGACCAAGG - Intergenic
983318900 4:166169571-166169593 TAGAAAACATTAGCCGAGCATGG - Intergenic
983720026 4:170839474-170839496 TAGGAAGCAGAACCTCAGGATGG - Intergenic
984162934 4:176275914-176275936 TAGAAGACAGAAAATGAGCTGGG + Intronic
984643376 4:182195482-182195504 TAGAAAAAATTAGCTGAGCATGG + Intronic
985121145 4:186643408-186643430 TAGCAAAAAGAATCTTAGCAAGG + Intronic
985291243 4:188390402-188390424 AAGAAAAGAGAACTTGTGCAGGG - Intergenic
985500402 5:240526-240548 TAAAAAACAAAACCAGTGCAGGG - Intronic
985981982 5:3477661-3477683 TTGGAAACAGAAGCTGAGAAAGG + Intergenic
986530211 5:8728513-8728535 AAGAAAAGAGAACCTTAGGAAGG + Intergenic
987100986 5:14591002-14591024 TAGAAAACAGAACTGGGGAAGGG + Intronic
987418094 5:17685971-17685993 TACAAAACATCAGCTGAGCATGG - Intergenic
988696955 5:33631548-33631570 TAGAAAACTGAACCTTAGAATGG - Intronic
989637411 5:43551018-43551040 TAGAATACAGAAACTGAGGATGG + Intronic
989716143 5:44466116-44466138 TAGAAAACAGAAAAAAAGCAGGG - Intergenic
991518420 5:67466222-67466244 TATAACCCATAACCTGAGCAGGG - Intergenic
993311955 5:86344796-86344818 TAAAAAACAGAAGCTTGGCAGGG + Intergenic
993394340 5:87364741-87364763 TAGCAAACAGCACCAGAGAAAGG + Intronic
993486943 5:88498435-88498457 TAGAAGACAGAGCCTGAGGCAGG + Intergenic
993904410 5:93606872-93606894 TAGAATACAGAGCCAGAGCTAGG - Intergenic
993966390 5:94365446-94365468 TAGAAATCAGAACCTAGACATGG - Intronic
994184417 5:96802605-96802627 TTAAAAACAGAACCAAAGCAAGG + Intronic
995066716 5:107870739-107870761 TACAAAAAAGTAGCTGAGCATGG - Intronic
995404141 5:111774780-111774802 TAGAAATCAGAATGTCAGCAGGG - Intronic
997119412 5:131158616-131158638 AAAAAAACAGAACCTTAGAAAGG + Intergenic
997452138 5:133992310-133992332 TTGAAAACAAAATCTGAGAATGG - Exonic
999318127 5:150597172-150597194 AAGAAAACAGTCCTTGAGCATGG - Intergenic
1000128448 5:158270723-158270745 AAGAAAACAGAGGCAGAGCATGG + Intergenic
1001178371 5:169494567-169494589 TAGAAAGCAGATCCAGTGCAGGG + Intergenic
1002025848 5:176395813-176395835 AACAAAACAGACACTGAGCATGG - Intronic
1003358139 6:5395011-5395033 TAGAAAAGAGAACTAGAGCAGGG - Intronic
1005210924 6:23461572-23461594 TTGAAAACAGAAAGTGAGTAGGG + Intergenic
1005665206 6:28045857-28045879 TAGTAAACAGTACCTAAACAAGG - Intergenic
1007062306 6:38952671-38952693 GAGAAAAGAGAACATGAACATGG - Intronic
1010227654 6:73506132-73506154 TAGAAAAAATTAGCTGAGCATGG - Intronic
1012187745 6:96242214-96242236 TAGAAAAGAGAACATGGGCCAGG + Intergenic
1013136398 6:107286882-107286904 TAGAAAAAATTAGCTGAGCATGG + Intronic
1013560436 6:111298160-111298182 CAGAAAACAGAACCAGAGACAGG + Intergenic
1014721502 6:124922830-124922852 TAGAAAAAATTAACTGAGCATGG - Intergenic
1016011642 6:139143178-139143200 TAGAAAACAGAGGCTGAGAAAGG - Intronic
1016381683 6:143490605-143490627 TTGAAAACAAAATCTGAGAATGG + Intergenic
1016825889 6:148388208-148388230 CTGAAAACAGAACCTGGGCCGGG - Intronic
1016849655 6:148604558-148604580 TACAAAACAGAACTTGAGTTGGG - Intergenic
1017675217 6:156806123-156806145 AAGAAAACAGAACCTCAACAAGG - Intronic
1019237843 6:170635546-170635568 TAGTAAACTGAAGCTCAGCATGG + Intergenic
1019782937 7:2954972-2954994 TACAAAACATCAGCTGAGCATGG + Intronic
1020219758 7:6226729-6226751 TATGCAGCAGAACCTGAGCAAGG + Intronic
1020230666 7:6316018-6316040 CAGATAACAAAACCTGGGCAAGG + Intergenic
1020898501 7:13972897-13972919 GTGAAAACAGAGCCTGGGCATGG - Intronic
1021520065 7:21530437-21530459 TTGAAAAGATTACCTGAGCATGG - Intergenic
1022650190 7:32267163-32267185 TAGAGACCCGACCCTGAGCAAGG + Intronic
1023768857 7:43536602-43536624 CAGAAAGCAGATTCTGAGCAGGG + Intronic
1024292482 7:47814840-47814862 TTGAAAATAAAAGCTGAGCAAGG + Intronic
1024794666 7:53007203-53007225 AAGAAAACAGAAACTCAGGAGGG + Intergenic
1025159208 7:56638714-56638736 TAGAAAACAGAAGAAGAGCAGGG + Intergenic
1026182588 7:68055102-68055124 TAGAAAACAGACCCTAGGCCAGG - Intergenic
1027436146 7:78166607-78166629 TAGAAACTAGACCATGAGCAAGG - Intronic
1027436855 7:78173649-78173671 TACAAAACCTAACCTAAGCACGG - Intronic
1027519258 7:79183022-79183044 TAGATACCAGAAGCTGAGAAAGG + Intronic
1028759610 7:94480871-94480893 TAGAAAACATAAACTGAAGAGGG + Intergenic
1029423226 7:100482564-100482586 TAGAAAAAATAAGCTGGGCATGG - Intergenic
1029445624 7:100611237-100611259 TAGAAAACAGACTTTGAGCCTGG + Intergenic
1030200670 7:106900379-106900401 TAGAAAACAGAAAAAAAGCAGGG - Intronic
1030253487 7:107478849-107478871 TAGAAAACAGGACCTTAGTAGGG + Intronic
1030966940 7:116004994-116005016 AAGAGAACAGAACTTGTGCAGGG - Intronic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1031891462 7:127298387-127298409 TAGAAAACAAAAAAAGAGCAGGG + Intergenic
1032700132 7:134372024-134372046 TGAAAACCAGAAGCTGAGCAAGG - Intergenic
1032840475 7:135709511-135709533 TAGAAAATATACCCTGAGCCTGG - Intronic
1034001185 7:147415005-147415027 TAGAAAACAGAACCCAAAGAGGG + Intronic
1034981049 7:155476899-155476921 TAGCAAACAGAATCTAAGCTGGG - Intronic
1036570620 8:9976985-9977007 AAGAGAACAGAACTTGTGCAGGG - Intergenic
1036793912 8:11742018-11742040 TAGAGAACAGATCCTGCCCAGGG - Intronic
1037748238 8:21663095-21663117 TAGAAAACAGTAAATGAACAAGG + Intergenic
1038405948 8:27323098-27323120 AAGAAAAGAGAACCTGAACCAGG + Intronic
1038554744 8:28501053-28501075 TAGAAAACAGATACTGGGCAGGG - Intronic
1038948823 8:32391284-32391306 TAAAAAACCCTACCTGAGCATGG - Intronic
1040464644 8:47683281-47683303 CAGCAAACAGCACCTTAGCATGG + Intronic
1041268424 8:56086851-56086873 TACAAAAAAGTATCTGAGCATGG + Intergenic
1041401445 8:57449700-57449722 TTGAAAACAGAGCCTCAGAAAGG - Intergenic
1042470579 8:69183074-69183096 GAGAAAACAGAATCAGAGCTAGG + Intergenic
1042566770 8:70119220-70119242 TAGATAACAGAGACTGAGAAGGG - Intronic
1042799935 8:72707685-72707707 AAGAAAACAGAACGTGAGTAAGG + Intronic
1043919513 8:85965227-85965249 TAGAAAACAAAACATGATTATGG - Intergenic
1043922577 8:86000520-86000542 TACAAAACACAACCTGTCCAGGG - Intronic
1043923133 8:86006554-86006576 TAAAAAACACAAACTGAGCTGGG + Intronic
1044236102 8:89831763-89831785 GAGAAAACAGAGCCTTAGTAAGG - Intergenic
1045546801 8:103136793-103136815 TAGAAAACAGACCTTCAGTAAGG - Intronic
1046368305 8:113267572-113267594 TAGAAAACAGAAACTTGGAAGGG + Intronic
1046787840 8:118287093-118287115 TAGAAACAAGAAACTGAGTAAGG + Intronic
1047574962 8:126142843-126142865 TTGAAAACAGAAACTATGCAGGG + Intergenic
1047953723 8:129957187-129957209 AAGAAAATAGAACATGAGAAAGG - Intronic
1049277780 8:141728502-141728524 TTGAAAACATAAACTGAGCGGGG + Intergenic
1049390245 8:142364031-142364053 GAGAAAACAAAACCTGGGGAGGG + Intronic
1050108073 9:2186388-2186410 GAGAAAACTGAGCATGAGCAGGG - Intronic
1050708892 9:8437105-8437127 AAGAAAACAGACACTGAGAAAGG + Intronic
1052662333 9:31449872-31449894 AAGAAAGCAGAAAGTGAGCAGGG + Intergenic
1052969253 9:34366789-34366811 GAGAAAACAGAGGCTTAGCAAGG + Exonic
1053629865 9:39925068-39925090 TAGAAAACATTAGCTGGGCATGG - Intergenic
1053775904 9:41538468-41538490 TAGAAAACATTAGCTGGGCATGG + Intergenic
1054214022 9:62325634-62325656 TAGAAAACATTAGCTGGGCATGG + Intergenic
1054365830 9:64340013-64340035 TAGAAAACATTAGCTGGGCATGG - Intergenic
1054673458 9:67829722-67829744 TAGAAAACATTAGCTGGGCATGG - Intergenic
1054710579 9:68507035-68507057 TTAAAAAGAAAACCTGAGCAAGG + Intronic
1055055441 9:72019379-72019401 CAGAAAACAGAACCTACACAGGG - Intergenic
1055211125 9:73793478-73793500 TAGAAAACAGAACAAAAGAAAGG + Intergenic
1055218199 9:73893785-73893807 TAGAAAACAGAACAGGTGAAGGG + Intergenic
1055512040 9:77004709-77004731 GAGAAAACAGAATCTTAGAAAGG + Intergenic
1056419805 9:86413189-86413211 TAGAAAAGACAACATGAACATGG + Intergenic
1056592544 9:87974886-87974908 TAGAAAACAGCACCTGCGCGTGG - Intergenic
1057549521 9:96041661-96041683 AAGAAAGCAGAAACTGGGCAGGG + Intergenic
1058117206 9:101098001-101098023 TATAACACTGAACCTGAACATGG + Intronic
1058345622 9:103957566-103957588 GAGACAGCAGGACCTGAGCAGGG + Intergenic
1059457377 9:114408044-114408066 GAGCAAACAGAAGCTGAGAAGGG + Intronic
1060000219 9:119951920-119951942 TTGAAAACAGAACCTAAGTCAGG - Intergenic
1062414902 9:136443392-136443414 CAGAAAAGAGAAGCTGGGCACGG + Intronic
1203426071 Un_GL000195v1:40044-40066 TAGAAAACAAACCCTTACCATGG - Intergenic
1185685068 X:1922046-1922068 TAGATAACAGAGCCCGAGAAGGG - Intergenic
1186091317 X:6051912-6051934 TAGATAACATAACCTAATCAAGG - Intronic
1186473074 X:9836250-9836272 GAGAAAACTGAGGCTGAGCATGG - Intronic
1186532439 X:10310931-10310953 AAGAAAAAAGAACATGGGCAGGG + Intergenic
1187387097 X:18858917-18858939 CAGAAAAGAGAACTTGTGCAGGG + Intergenic
1188444118 X:30238988-30239010 TGAAATACAGAACCAGAGCAAGG + Intergenic
1189146169 X:38657355-38657377 TTAAAAACAGAATCTGAACACGG - Intronic
1189297400 X:39928800-39928822 TAGACAGCAGAAACTCAGCATGG - Intergenic
1190359160 X:49633240-49633262 TTGAAAACAAAATCTGAGAATGG - Intergenic
1192834327 X:74783172-74783194 TAGAAAATAGCATCTGAGCTTGG + Intronic
1193294352 X:79817070-79817092 TAGAAAACAGAAAATAAGGAGGG - Intergenic
1194283633 X:91983393-91983415 TTGAAAACAAAATCTGAGAATGG - Intronic
1194947580 X:100087670-100087692 AAGAAAACAGAACATGGGCCAGG + Intergenic
1196777162 X:119349643-119349665 AAGAAAAAAAAATCTGAGCATGG + Intergenic
1197553572 X:127925980-127926002 TAGATACCAGAAGCTGAGAATGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199040019 X:143102421-143102443 TAGTCAATAGAACCTGATCAAGG + Intergenic
1199306808 X:146277132-146277154 TGGAAAACAGAAAAAGAGCAGGG - Intergenic
1199885127 X:152012925-152012947 TAGAAAACAGAGACTGGGAAGGG + Intergenic
1200390498 X:155940489-155940511 TAGAAAGAGAAACCTGAGCAAGG - Intronic
1200601206 Y:5207957-5207979 TTGAAAACAAAATCTGAGAATGG - Intronic
1201310042 Y:12588686-12588708 TAGAAAAAATTACCTGGGCATGG - Intergenic
1201362264 Y:13165726-13165748 TAGAAAACAAAAGCTCAGAAAGG + Intergenic
1201548979 Y:15198650-15198672 TAGCCAACAGAACGTGGGCAAGG + Intergenic