ID: 959619975

View in Genome Browser
Species Human (GRCh38)
Location 3:108389509-108389531
Sequence AAGCAGGACTGGAGGGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 517}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959619975 Original CRISPR AAGCAGGACTGGAGGGTTGT GGG (reversed) Intronic
900345973 1:2210451-2210473 AAGCAGGCGTGGAGGGTAGGAGG - Intronic
900484852 1:2917614-2917636 AGGCAGGACAGGAGCGTGGTTGG - Intergenic
901022885 1:6263943-6263965 AAGCCAGACAGGGGGGTTGTGGG + Intergenic
902117774 1:14136208-14136230 AGGCAGGACTGCAGAGTTTTGGG + Intergenic
904711489 1:32433571-32433593 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
905108548 1:35577961-35577983 AAGCAGGACTGGTGGGGAGACGG + Intronic
905254619 1:36672248-36672270 AAGCAGGAAAGGAGCGTTGCTGG - Intergenic
905499633 1:38426339-38426361 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
906080772 1:43086750-43086772 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
906744675 1:48213464-48213486 AAGGAGGACTGGAGGGTGGAAGG + Intergenic
907251000 1:53139445-53139467 AAGCTGGACTTGAGGGTATTGGG - Intronic
907292478 1:53425533-53425555 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
907521101 1:55023862-55023884 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
907715084 1:56919052-56919074 AGGCATGACTGGAGGGCTGTGGG - Intergenic
908461854 1:64354417-64354439 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
908592098 1:65646333-65646355 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
908772156 1:67607142-67607164 AAGCAGAGCTGGATGGATGTAGG + Intergenic
908936312 1:69381248-69381270 AAGCATGACTGGAGTGTTAGAGG - Intergenic
909014566 1:70368611-70368633 AAGGAAGACTGGAGGGTGGAAGG - Intronic
909035322 1:70589573-70589595 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
909729239 1:78873161-78873183 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
909909817 1:81246698-81246720 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
911148192 1:94571651-94571673 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
911570259 1:99510898-99510920 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
911983706 1:104597224-104597246 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
912815470 1:112824981-112825003 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
913596871 1:120386840-120386862 AGGCAGGACTGGCAGGTTGTGGG - Intergenic
914090397 1:144492141-144492163 AGGCAGGACTGGCAGGTTGTGGG + Intergenic
914308211 1:146442081-146442103 AGGCAGAACTGGCAGGTTGTGGG - Intergenic
914593896 1:149131052-149131074 AGGCAGAACTGGCAGGTTGTGGG + Intergenic
915254640 1:154617118-154617140 AAGCAGGACAGGACGCTTGCAGG - Intronic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915744822 1:158147746-158147768 GAGCAGGGCTGAGGGGTTGTGGG + Intergenic
917961743 1:180151071-180151093 AAGAAGGATTGGAGGATTGGAGG + Intergenic
918346969 1:183614908-183614930 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
918416960 1:184320031-184320053 GAGCAGGACTGGAGGGGTGGGGG - Intergenic
919476252 1:198036054-198036076 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
920682364 1:208082905-208082927 AGGCAGATCTGCAGGGTTGTGGG - Intronic
920901683 1:210115271-210115293 AAGGAGGAATGGAGGGTGGAAGG + Intronic
920907864 1:210188566-210188588 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
921459925 1:215414392-215414414 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
921509121 1:216009263-216009285 AAGAAGGAATGGAGGGTGGAAGG - Intronic
921519986 1:216146808-216146830 AAGGAGGAATGGAGGGTGGAAGG - Intronic
921733116 1:218598238-218598260 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
922906255 1:229175696-229175718 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
923075068 1:230602515-230602537 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
923244606 1:232119439-232119461 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
924180510 1:241435235-241435257 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
924421094 1:243910875-243910897 CAGCAGGCCTGGAGGGTTCGGGG + Intergenic
924441129 1:244086386-244086408 AAGGAGGAGTGGACGGGTGTAGG - Intergenic
1062954026 10:1528627-1528649 CAGCATGACAGGAGGGGTGTGGG - Intronic
1063106557 10:2997468-2997490 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1064887136 10:20123612-20123634 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1065443345 10:25773656-25773678 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1065610380 10:27466352-27466374 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1066437508 10:35407714-35407736 AAGGAGGAGTGGAGGGTGGAAGG + Intronic
1067360233 10:45572351-45572373 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1068230827 10:54168016-54168038 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1068592484 10:58865449-58865471 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1068635082 10:59339492-59339514 AAGCTAGACAGGAGGTTTGTAGG - Intronic
1070490500 10:76971446-76971468 AAGCAGGTTTGGAGGGTAGTTGG - Intronic
1070649561 10:78225187-78225209 AAGAAGGACCAAAGGGTTGTGGG - Intergenic
1070665524 10:78340205-78340227 AAGTAGAACTGGTGGGTTGAAGG + Intergenic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1071960976 10:90808704-90808726 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1072011425 10:91305961-91305983 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1073013734 10:100381890-100381912 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1073775869 10:106785350-106785372 AAGGAGGAGAGGAGGGATGTAGG - Intronic
1074221827 10:111445559-111445581 AAGCAGGAGTGTTGGGATGTAGG + Intergenic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1075074169 10:119339522-119339544 AGGCAGGAGTGGGGGGTTGCAGG + Intronic
1075328787 10:121556929-121556951 AAGCAGAACTGCAGGGTAGTGGG - Intronic
1075330262 10:121568948-121568970 AAGCAGGAATGGAGAGGCGTGGG - Intronic
1075714152 10:124546192-124546214 GAGCAGGGTAGGAGGGTTGTTGG + Intronic
1075777025 10:124995762-124995784 AGGCAGGACTGGACGGTGGCAGG + Intronic
1076040852 10:127247330-127247352 AAGAAGGACAGGAGGAATGTGGG - Intronic
1076774762 10:132688535-132688557 ACTCAGAACTGCAGGGTTGTGGG + Intronic
1077204086 11:1333217-1333239 AAGCGGCACTGGAGGCTTGGGGG + Intergenic
1077677850 11:4213256-4213278 AAGCTGCACTGCACGGTTGTCGG - Intergenic
1078046270 11:7916612-7916634 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1078063044 11:8060612-8060634 AAGCAGGAGTTGAGGGTGATGGG + Intronic
1078603131 11:12750944-12750966 AAACAGGACTGAATGGTTGCCGG - Intronic
1078920493 11:15826156-15826178 GAGCAGGCCTGGAGAGGTGTCGG - Intergenic
1079230375 11:18644267-18644289 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1080028054 11:27633527-27633549 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1081159504 11:39735256-39735278 AAGGAGGAATGGAGGGTGGGAGG - Intergenic
1081936631 11:46908777-46908799 AATCAGCACTCGAGTGTTGTTGG + Intronic
1083261179 11:61523947-61523969 AGGCACGACAGGAGGGGTGTGGG + Intronic
1084162406 11:67356914-67356936 AAGAAGGTGTGGAGGGTGGTAGG - Intronic
1084275679 11:68049890-68049912 GAGCAGGCCTGGCGGGTGGTGGG + Intronic
1084579563 11:70014664-70014686 GAGCAGGATTGCTGGGTTGTGGG + Intergenic
1084613416 11:70218747-70218769 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1085627091 11:78081844-78081866 AAGAAGGAATGGAGGGCTGAAGG - Intergenic
1085934118 11:81123076-81123098 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1086550054 11:88044413-88044435 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1087168057 11:95023995-95024017 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1087314534 11:96589187-96589209 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1087384897 11:97458598-97458620 AAGCAGGACTGGAAAAGTGTAGG + Intergenic
1087687333 11:101279932-101279954 AAGCAAAACTGGAGATTTGTAGG + Intergenic
1088490321 11:110380511-110380533 AAGCATGACTGCAAGGTTTTTGG + Intergenic
1088791920 11:113233684-113233706 AAGCAGGACTGGCCGGGTGTCGG - Intronic
1089307143 11:117533790-117533812 AAACTGGACTTGAGGGTTGGGGG + Intronic
1089867205 11:121642400-121642422 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1089953105 11:122547823-122547845 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1089987289 11:122825877-122825899 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1090226188 11:125073491-125073513 AAGAAGGACTGGAGGGGTGGAGG - Intronic
1091586668 12:1820835-1820857 AGGAAGGAATGGAGGGTTGGTGG + Intronic
1091645677 12:2270656-2270678 AAGCAGGAGTGGAAGGTCATTGG + Intronic
1091725896 12:2846178-2846200 GAGCAGGGCTGGAAGGTGGTGGG + Intronic
1092063448 12:5569422-5569444 AAGGAGGACTGGAGGGGTGAGGG - Intronic
1092626891 12:10337379-10337401 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1092723859 12:11466621-11466643 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1092840000 12:12531201-12531223 AAACAGGACTGGAAGGCTCTAGG + Intronic
1093268154 12:17026134-17026156 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1093812995 12:23510491-23510513 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1094316204 12:29139487-29139509 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1095128003 12:38504851-38504873 AAGCAGGTCTGGAGGTTGGAAGG + Intergenic
1095998282 12:48107673-48107695 AAGGAGGACTTGAGAGTTGAGGG + Intronic
1095999234 12:48114956-48114978 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1096907335 12:54947401-54947423 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1098069288 12:66654673-66654695 AAGGAGGAGAGGAGGGCTGTGGG + Intronic
1098173781 12:67771083-67771105 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1098251028 12:68569806-68569828 AAGCAAGACTGGAGGGCATTGGG - Intergenic
1099188566 12:79541132-79541154 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1099451714 12:82815692-82815714 AAGCAGGAATGAAAGTTTGTAGG + Intronic
1099762448 12:86940059-86940081 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1100141060 12:91619384-91619406 AAGTAGGGTTGGAGGGTTGTGGG + Intergenic
1100561198 12:95750350-95750372 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1102419279 12:112791304-112791326 ATGCAGGACTGGGGGCGTGTGGG + Intronic
1102571048 12:113827311-113827333 GGGCAGGACTGGGGGGTTGTCGG - Intronic
1102884163 12:116508876-116508898 AAACTGGAATCGAGGGTTGTTGG + Intergenic
1105986667 13:25573870-25573892 GAGAAGGAGTGGAGAGTTGTGGG + Intronic
1105990583 13:25616226-25616248 AAGAAGGACTGGAAGATTGTTGG - Intronic
1107075436 13:36317705-36317727 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1107348323 13:39487370-39487392 GAGCAGGACAGGAGAGCTGTAGG - Intronic
1108149397 13:47516943-47516965 ATGCAGGACTGGAGGAGTGGCGG - Intergenic
1108804016 13:54132149-54132171 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1108919691 13:55659425-55659447 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1110765326 13:79275395-79275417 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1110845185 13:80184819-80184841 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1111126183 13:83912717-83912739 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1114224294 14:20723864-20723886 AGGCAGTACTGGAGTGTTATAGG + Intergenic
1114830410 14:26134661-26134683 AAGAAGGAGTGGAAGGTTGAGGG + Intergenic
1115643758 14:35352529-35352551 AAGCAGGAATGGAGGCTGGGGGG + Intergenic
1116179534 14:41517218-41517240 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1117837068 14:59818877-59818899 GTGCAGAACTGGTGGGTTGTTGG + Intronic
1118536064 14:66766021-66766043 AAGCAGGACTTGAGGGATAATGG + Intronic
1118876764 14:69792644-69792666 AAGCAGGACTGCTGGGTCGTGGG - Intronic
1118937452 14:70300641-70300663 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1119193794 14:72702351-72702373 AGGCAGGACTGGAGTCTTGGAGG - Intronic
1119317054 14:73704753-73704775 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1119560477 14:75585481-75585503 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1120548533 14:85840899-85840921 AACCAGGAGTGGAGAGTTTTCGG + Intergenic
1120566639 14:86067384-86067406 AAGCATAACTGGAGGTTTTTGGG + Intergenic
1120660105 14:87239474-87239496 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1121289211 14:92760753-92760775 AAGAAGGAATGGAGGGTGGAAGG - Intergenic
1122040850 14:98986465-98986487 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1122381487 14:101310130-101310152 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1122385422 14:101342046-101342068 AAGCAGGGCTGGGGGATGGTGGG - Intergenic
1122802256 14:104237618-104237640 TAGCAGCACTGGAAGGTGGTGGG - Intergenic
1122869735 14:104632795-104632817 AGGCAGGGCTGGAGGGTGGCAGG - Intergenic
1123179084 14:106451051-106451073 AAGCAGGAGTAGAGGGTTGCTGG - Intergenic
1123213223 14:106781652-106781674 AAGCAGGGGTAGAGGGTTGCTGG - Intergenic
1123882633 15:24689995-24690017 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1124624407 15:31299862-31299884 GAGCAGGACTGGGGGCTTGCAGG + Intergenic
1125629018 15:41132384-41132406 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1125848945 15:42885781-42885803 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1126063380 15:44805531-44805553 ACGCATGACTTGAGGGTTATTGG - Intergenic
1126410621 15:48369555-48369577 TGGTAGGAGTGGAGGGTTGTGGG - Intergenic
1126581552 15:50246803-50246825 ACTCAAGACTGGAGGGTTGTGGG - Intronic
1126843603 15:52739852-52739874 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1130328956 15:82904656-82904678 AAGTAGGACAGGATGGTTGAAGG - Intronic
1130854971 15:87832534-87832556 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1130947622 15:88560925-88560947 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1131535882 15:93237642-93237664 GAGCAGGATTGGAGAGTTGGAGG - Intergenic
1131565035 15:93478077-93478099 ATGCTGGGGTGGAGGGTTGTGGG + Intergenic
1131684032 15:94752002-94752024 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1132439208 15:101841951-101841973 ACCCAGGGCTGGAGGGCTGTGGG - Intergenic
1132999353 16:2841292-2841314 AAGGAGGCCGGGAGGATTGTGGG - Intergenic
1133651252 16:7815964-7815986 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1133960540 16:10489059-10489081 AAGCAGTATTGGAGTGTTTTAGG - Intergenic
1134844905 16:17431852-17431874 TAGCAAGACTGGAGGGTGGAAGG + Intronic
1135094794 16:19555924-19555946 AAGCCAGACTGGCGGGTTCTTGG + Intronic
1137363288 16:47839759-47839781 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138355318 16:56373174-56373196 AAGCAGGAAGGGATGCTTGTTGG - Intronic
1138759254 16:59522082-59522104 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1138804797 16:60080095-60080117 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1143137430 17:4719704-4719726 GAGCAGGAAAGGAGGGTTCTGGG + Intronic
1143323479 17:6082919-6082941 AATAAAGACTGGAGGGCTGTGGG + Intronic
1144185194 17:12789967-12789989 AAGGAGGACTGGAGGCTGGGCGG - Intronic
1146429079 17:32773604-32773626 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1146597749 17:34184537-34184559 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1146711830 17:35048649-35048671 TGGCTGGACTGCAGGGTTGTGGG - Intronic
1147257835 17:39192660-39192682 GAGGAGGACTGCAGGGATGTAGG + Intronic
1149256480 17:54832992-54833014 GAGCAGGACTGCAGGGTCATAGG - Intergenic
1150860644 17:68797068-68797090 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1152779453 17:82219828-82219850 AGGCAGGACTGGAGTGTGGAAGG - Intergenic
1155892846 18:31288710-31288732 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1155941398 18:31805037-31805059 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1155961803 18:32001513-32001535 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1156302103 18:35845126-35845148 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1157906551 18:51574520-51574542 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1158433199 18:57410810-57410832 AGGCTGGGCTGGAGGGGTGTTGG - Intergenic
1159929070 18:74293714-74293736 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160820253 19:1054518-1054540 AAGCAAGCCTGGAGGGTGGATGG + Intronic
1161106751 19:2447595-2447617 AAGGAGGACCGGAGGATGGTAGG + Intronic
1161711062 19:5848314-5848336 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1163303181 19:16460852-16460874 AACCAGGACTGTACGGTTATGGG - Intronic
1163900431 19:20095444-20095466 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1164459372 19:28434321-28434343 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1165510455 19:36263917-36263939 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1165845630 19:38816225-38816247 AGCCAGGCCTGGAGGGTTGGAGG - Intronic
1166851072 19:45761609-45761631 AAGCAGTACTGGGGGGATGAAGG + Intronic
1166905946 19:46108529-46108551 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1166917024 19:46202441-46202463 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1167099261 19:47393940-47393962 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1167277989 19:48550399-48550421 AAGCAGAAAAGGAGGGTTCTGGG - Intergenic
1168212267 19:54899361-54899383 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
925544406 2:5002243-5002265 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
925605564 2:5656210-5656232 AGGCAGAACTGGCAGGTTGTGGG - Intergenic
926407632 2:12571036-12571058 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
926413454 2:12627780-12627802 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
926464227 2:13168421-13168443 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
927345216 2:22030363-22030385 AAGGATAACTTGAGGGTTGTGGG + Intergenic
928387819 2:30884765-30884787 AGGCAGGACTGGGCGGTTGGGGG - Intergenic
928857020 2:35814333-35814355 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
929301612 2:40309959-40309981 AAGCAGGAGTGAATGGTTATTGG - Intronic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
929634437 2:43503184-43503206 AAGTAGAATTGCAGGGTTGTAGG - Intronic
929684682 2:44023514-44023536 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
929793218 2:45038878-45038900 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
930601460 2:53448358-53448380 AAGGAAGACTGGAGGATTCTGGG + Intergenic
933012948 2:77089640-77089662 AAGGAGGAATGGAGGGTGGAAGG - Intronic
933179911 2:79216277-79216299 AAGGAGGAATGGAGGGTGGAAGG + Intronic
933230682 2:79803617-79803639 CACCAGCACTGGAAGGTTGTGGG - Intronic
933665755 2:84963596-84963618 AACCAGGAGTGCAGGGTTGAAGG + Intergenic
934851148 2:97702098-97702120 AGGCAGGACTGAAGGGCTGTGGG - Intergenic
937203262 2:120219472-120219494 AAGATGGGCTGGGGGGTTGTGGG + Intergenic
938172337 2:129090429-129090451 ATGCAGACCAGGAGGGTTGTGGG + Intergenic
939460879 2:142494315-142494337 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
940216666 2:151310066-151310088 AAGGAGGAGTGGAGGGTGGAAGG - Intergenic
941456342 2:165714942-165714964 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
943413074 2:187564925-187564947 AAGGAGGAATGGAGGGTGGAAGG + Intronic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
943865212 2:192919326-192919348 AAGAAGGAATGGAGGGTGGAAGG - Intergenic
943951442 2:194135356-194135378 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
944387302 2:199180638-199180660 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
944393987 2:199248189-199248211 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
945153249 2:206811288-206811310 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
945375963 2:209079339-209079361 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
945938166 2:215923635-215923657 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
946017907 2:216619116-216619138 AAGCCAGGCAGGAGGGTTGTGGG + Intergenic
946445242 2:219733857-219733879 AAGCAGCCCAGCAGGGTTGTGGG - Intergenic
946886351 2:224226550-224226572 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
946893135 2:224297951-224297973 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
947007630 2:225530283-225530305 AAGCAGGAAGGGAGGGATGCAGG - Intronic
948641031 2:239376029-239376051 AAGCAGGGCTGGCAGGTTCTGGG + Intronic
1168739199 20:173772-173794 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1170069005 20:12344710-12344732 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1170106092 20:12755148-12755170 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1170161262 20:13313524-13313546 CAGCAGGGCTGGAGTGTTGCTGG + Intergenic
1173083715 20:39894499-39894521 AAGCAGGACTTCAGGAATGTAGG + Intergenic
1173658661 20:44718261-44718283 AAGCAGGTTTGCAGGATTGTGGG + Intronic
1173998763 20:47359085-47359107 AAACAGGACTGTGGGGTTGGTGG + Intergenic
1175589771 20:60179834-60179856 AAGGGGGAATGGAGAGTTGTTGG - Intergenic
1175687822 20:61044301-61044323 AAGCAGGGCTGAAGGGCTGAAGG - Intergenic
1177031330 21:15984271-15984293 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1177100481 21:16893432-16893454 AAGCAGGAATGGAGGGTGGAAGG - Intergenic
1177119417 21:17122730-17122752 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1178001051 21:28162427-28162449 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1178265962 21:31142875-31142897 AAGCAGCCCTGGGGAGTTGTGGG + Intronic
1179062950 21:37996483-37996505 AAGCAGGCCTGGAGAGGTGGTGG + Intronic
1179568185 21:42262078-42262100 AACCAGGACTGGGGGGTTAATGG + Intronic
1180082773 21:45494252-45494274 AAGCAGGGGTGGAGGGTGGAGGG - Intronic
1180560747 22:16612518-16612540 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1180750155 22:18119010-18119032 AGGCAGGACTAGAGGGTGGTCGG + Intronic
1180919488 22:19513564-19513586 AAGCAGGTCTAGAGAGCTGTAGG - Intronic
1182998459 22:34835609-34835631 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1183635816 22:39061968-39061990 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1183684244 22:39352233-39352255 GAGCAGGACTGGGAGGCTGTGGG - Intronic
1184416048 22:44352490-44352512 AAGCAGGTCTGGCGGGCTGGGGG + Intergenic
1184510503 22:44930548-44930570 AGGCGGGACAGGAGGGTGGTGGG + Intronic
1185082747 22:48718761-48718783 ACGGAGGACTGGAAGGTTGGGGG - Intronic
949190542 3:1244225-1244247 AAGGAGGAATGGAGGGTGGAAGG + Intronic
949671009 3:6398918-6398940 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
950315439 3:11997965-11997987 AGGCAGGACTGAAGGGTCGGGGG + Intergenic
951298954 3:20971975-20971997 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
952018028 3:28982608-28982630 TAGCAGCACTGAAAGGTTGTGGG + Intergenic
952296670 3:32068472-32068494 AAGGAGGAATGGAGGGTGGAAGG - Intronic
952372514 3:32736893-32736915 AAGCAGTATTGGAGGGGTGGGGG + Intronic
952379792 3:32795894-32795916 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
952895409 3:38075487-38075509 AAGGAGGAATGGAGGGTGGAAGG + Intronic
952896202 3:38080707-38080729 AAGGAGGAATGGAGGGTGGAAGG + Intronic
953077276 3:39582247-39582269 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
953834610 3:46331882-46331904 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
954161948 3:48729217-48729239 AAGGAGGAATGGAGGGTGGAAGG + Intronic
955080062 3:55650035-55650057 AATCAGGCTTGGAGGGTTGGAGG - Intronic
955253214 3:57304933-57304955 AAGGAGGAATGGAGGGTGGAAGG - Intronic
955503289 3:59606276-59606298 AATCAGGTCTGGAGGGTAGCCGG + Intergenic
956233654 3:67043178-67043200 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
959619975 3:108389509-108389531 AAGCAGGACTGGAGGGTTGTGGG - Intronic
960929318 3:122828575-122828597 AAGCAGGCCTGAAGGGTTTAAGG + Intronic
961343862 3:126248289-126248311 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
961880911 3:130060535-130060557 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
962425977 3:135269809-135269831 AAGGTGGACTGGAGGGGTGGTGG + Intergenic
962524174 3:136222724-136222746 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
962712977 3:138102923-138102945 AAGCAGGAGTGGAGGCAGGTGGG + Intronic
963052010 3:141150560-141150582 AAGCAAGCCTGGAGGTGTGTGGG - Intergenic
963468463 3:145711626-145711648 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963520295 3:146354808-146354830 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963521475 3:146363309-146363331 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963663192 3:148152913-148152935 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963684185 3:148415610-148415632 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
963969175 3:151410292-151410314 AATCAGGAATGCAGGGGTGTTGG + Intronic
964024378 3:152054474-152054496 AAGCAAGACTGGAGAGTTTAAGG + Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964125611 3:153231165-153231187 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
964176237 3:153828096-153828118 AAGGAGGAATGGAGGGTTGAAGG + Intergenic
964983493 3:162713636-162713658 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
965117981 3:164515635-164515657 AAGCAGCTCTGAAGGGTTCTGGG + Intergenic
965713254 3:171577681-171577703 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
965862128 3:173160382-173160404 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
966232987 3:177670279-177670301 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
966919618 3:184603092-184603114 CAGCTGGAGTGGAGGGTTCTAGG - Intronic
967212313 3:187179960-187179982 AAGGAGGAATGGAGGGTGGAAGG + Intronic
967494761 3:190130273-190130295 CAGCAGGACTGGACTGGTGTAGG - Intergenic
967658258 3:192075527-192075549 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
968927907 4:3559621-3559643 GATCAGGACTGGAAGGATGTGGG + Intergenic
968993242 4:3928640-3928662 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
969534930 4:7750401-7750423 AAGGATGACTGCAGGGTTGCTGG + Intergenic
970041950 4:11807523-11807545 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
970227581 4:13875753-13875775 AAACAGTAGTGTAGGGTTGTTGG - Intergenic
970256569 4:14174958-14174980 AAGAAGGAATGGAGGGTGGAAGG + Intergenic
971327914 4:25658923-25658945 GAGCAGGAGGGGAGGGTGGTGGG - Intronic
972071284 4:35021256-35021278 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
974608605 4:64185286-64185308 AAGCATGACTTCAGGGTTTTAGG + Intergenic
975800588 4:78056625-78056647 CAGCAGGAGTGGCGGGCTGTGGG + Intergenic
975865236 4:78718309-78718331 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
976558423 4:86475835-86475857 AAGGAGGAATGGAGGGGTGAAGG - Intronic
977041868 4:92027105-92027127 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
977075358 4:92443411-92443433 AAGGAGGAATGGAGGGTGGAAGG + Intronic
977198028 4:94085184-94085206 AAGCAGGATTGGGGCGGTGTGGG + Intergenic
979054773 4:115980104-115980126 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
979146473 4:117253349-117253371 AAGGAGGAGTGGAGGGTGGAAGG - Intergenic
979379788 4:119995181-119995203 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
979640823 4:123011760-123011782 AAGGAGGAATGGAGGGTGGAAGG + Intronic
980112074 4:128645279-128645301 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
980388778 4:132119462-132119484 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
980903788 4:138929133-138929155 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
981525059 4:145700386-145700408 AAGGAGGAATGGAGGGTGGAAGG - Intronic
981539578 4:145834002-145834024 AAGGAGGAATGGAGGGTGGAAGG - Intronic
981569544 4:146137046-146137068 AAGCAGGACTTCAGGGTTGGTGG - Intergenic
981715053 4:147744541-147744563 AAGCAGGACTGGAGGTTGGGGGG + Intronic
982414340 4:155112899-155112921 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
982535299 4:156601557-156601579 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983023721 4:162710361-162710383 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983055338 4:163094364-163094386 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983360272 4:166717559-166717581 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
983883917 4:172960860-172960882 AAGGAGGAATGGAGGGTGGAAGG + Intronic
984419123 4:179496962-179496984 AAGCAGGCATGGAGAGTTGTAGG + Intergenic
984936995 4:184898219-184898241 CAGCAGGACAGGAAGGCTGTGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985390023 4:189483914-189483936 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
985485613 5:146611-146633 AAGGAGAACTGCAGGGTTGGGGG - Intronic
985582206 5:704050-704072 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
985631781 5:1017749-1017771 AGGCAGGCCTGGAGGGCTCTGGG + Intronic
985893871 5:2737956-2737978 AGGCAGGACAGGTGGGCTGTGGG - Intergenic
986388734 5:7264860-7264882 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
987281892 5:16421267-16421289 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
988793426 5:34630333-34630355 AAGCAGGACAGGGGGATTCTAGG - Intergenic
990565271 5:57021455-57021477 AAGAAGGAATGGAGGGTGGAAGG + Intergenic
992364302 5:76076251-76076273 AAGCTGGACTGGATGTTGGTAGG + Intergenic
992394517 5:76358614-76358636 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
994126271 5:96171359-96171381 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
994779156 5:104068986-104069008 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
995457641 5:112368924-112368946 AACGGGGGCTGGAGGGTTGTGGG - Intronic
995690591 5:114822174-114822196 AAGCAGGACTGCAGTTTTATAGG - Intergenic
995899517 5:117050811-117050833 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
996052818 5:118951693-118951715 AAGGAGGAATGGAGGGTGGAAGG + Intronic
996509759 5:124305034-124305056 AAGGAGGACTGGAGGGTGGAAGG - Intergenic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
996940649 5:129001235-129001257 AAGCAGGAAAGGAGTGGTGTGGG - Intronic
997267708 5:132505738-132505760 AAGCAGAACTAGAGGGCTCTGGG - Intergenic
997679054 5:135736460-135736482 AGGGAGGAATGGAGGGTGGTAGG + Intergenic
997769821 5:136544065-136544087 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
997772786 5:136569785-136569807 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
998507238 5:142681783-142681805 ATGCAGGAATTGAGGCTTGTTGG - Intronic
998667459 5:144314602-144314624 AGGGAGGACTGGAGGATGGTAGG + Intronic
999067920 5:148711415-148711437 AAACAGGACTGAAAGGATGTGGG + Intergenic
999098295 5:149001077-149001099 ATGCAGGAATGGAGGGTGTTAGG - Intronic
999169111 5:149578283-149578305 AAGCAGCACTGGAGTCTTTTGGG - Intronic
999498733 5:152125666-152125688 AAGAAAGAGTGGAGGGCTGTGGG - Intergenic
1000335573 5:160239072-160239094 TATCAGGACTTGGGGGTTGTGGG + Intergenic
1000606778 5:163335276-163335298 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1000885478 5:166743562-166743584 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1000935791 5:167302350-167302372 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1003031690 6:2606551-2606573 AAGCTTTGCTGGAGGGTTGTCGG - Intergenic
1004106112 6:12668644-12668666 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1004283672 6:14301402-14301424 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1004508143 6:16263444-16263466 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1006362119 6:33592528-33592550 GAGCAGGACTGGTGGGTTTGAGG + Intergenic
1006503572 6:34473590-34473612 AGGCAGGGCTGGAGGGCTGGGGG + Intronic
1007786211 6:44280912-44280934 AACCAGAATTAGAGGGTTGTAGG - Intronic
1008476374 6:51939410-51939432 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1008878525 6:56355752-56355774 AACCATGAGTTGAGGGTTGTTGG + Intronic
1009267810 6:61578144-61578166 TGGCAGGGCTGAAGGGTTGTGGG + Intergenic
1009378999 6:63006538-63006560 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1009750455 6:67873427-67873449 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1010071875 6:71753029-71753051 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1010586843 6:77664986-77665008 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1010927227 6:81757203-81757225 AAGCAGGACAGGAATGTTGGGGG - Intergenic
1013322739 6:109010306-109010328 ACACAGGACTGGAGGGATCTGGG - Intronic
1013408029 6:109860194-109860216 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1013808285 6:114017150-114017172 AAGTAGGAATGGAGGGTGGAAGG + Intergenic
1014115493 6:117664168-117664190 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1014395861 6:120926100-120926122 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1014455014 6:121624875-121624897 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1014614813 6:123586729-123586751 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1014700596 6:124682932-124682954 AAGCATGACAGGAGAGCTGTGGG - Intronic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1015110350 6:129585860-129585882 AAGCAGGAATTGAGGGGTGTGGG - Intronic
1015288182 6:131508732-131508754 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1015905013 6:138107637-138107659 GAGCGGGACTGGAGGGTTGTGGG - Intergenic
1016114293 6:140261859-140261881 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1016248712 6:142017073-142017095 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1016401314 6:143683815-143683837 AAGTGGGACTGGAGGATTCTGGG - Intronic
1016499656 6:144705149-144705171 AGGCAGGTAAGGAGGGTTGTTGG + Intronic
1016783259 6:147983607-147983629 AAGCAGAATTGGAGTCTTGTTGG + Intergenic
1017038605 6:150289399-150289421 AAGCAGGACTGGAGAGCTGAGGG + Intergenic
1017779479 6:157705121-157705143 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1017923050 6:158887858-158887880 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1018112741 6:160551055-160551077 AAACAGGATTGCAGGTTTGTAGG + Intronic
1018495555 6:164343191-164343213 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1018521621 6:164656603-164656625 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1019537708 7:1537756-1537778 AGGCAGGGCTGGAGGGTGGAGGG + Intronic
1019974455 7:4569483-4569505 AAGGAGTGCTGGAGGGATGTGGG - Intergenic
1020141160 7:5612699-5612721 CAGCAGAACTGGTGGGTTGAGGG + Intergenic
1020532857 7:9357855-9357877 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1023699038 7:42875059-42875081 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1024701297 7:51906903-51906925 ACCCAGGACTGGGGGGCTGTGGG + Intergenic
1025260339 7:57414008-57414030 AAGCAGGGATGGAGGGTCCTGGG + Intergenic
1026117199 7:67505923-67505945 AAGCAGGACTGGACAGTTTATGG - Intergenic
1026815968 7:73512147-73512169 AAGGTGGACTGGAGGGCTGTGGG - Intronic
1027705303 7:81525505-81525527 AAGCAGAAATGGAAAGTTGTAGG - Intergenic
1028847081 7:95493685-95493707 AAGAAGAACTGGGGGGTTGGGGG - Intronic
1029500065 7:100923397-100923419 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1030163768 7:106532885-106532907 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031004527 7:116456781-116456803 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1031364895 7:120890095-120890117 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031399842 7:121316845-121316867 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1031525446 7:122818179-122818201 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1031728076 7:125263354-125263376 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1031776181 7:125911247-125911269 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1032198836 7:129805102-129805124 AAGCAGGCCTGGAGGATGGGTGG + Intergenic
1033676101 7:143541675-143541697 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1033695733 7:143787764-143787786 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1033909606 7:146247811-146247833 AAGGAGGAATGGAGGGTGGATGG + Intronic
1034033192 7:147790228-147790250 GAGCAGGGCTGGAGGGGTGCTGG - Intronic
1034333927 7:150308244-150308266 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1034866110 7:154643779-154643801 AAGAAGGAGGGGAGGGTTGAAGG + Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1036525316 8:9529401-9529423 AAGCAGGGGTGGGGGGTGGTGGG - Intergenic
1037602515 8:20409545-20409567 TACCAGAACTGGAGGGTTGGTGG + Intergenic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1040647865 8:49420708-49420730 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1041426331 8:57725007-57725029 AAGAGGGACTGGAGGCTTGCTGG - Intergenic
1041652002 8:60310999-60311021 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1041917686 8:63152786-63152808 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1042707214 8:71676171-71676193 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1043414676 8:80034412-80034434 AAGCATGGCTGGGGGGTTGCAGG - Intronic
1043718042 8:83509580-83509602 AAGCAGGAATGGAGGGTGGAAGG + Intergenic
1045117792 8:99002831-99002853 AGGCAGGAGTGGAGGAGTGTGGG + Intergenic
1046074748 8:109302071-109302093 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1046439916 8:114242900-114242922 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1046443105 8:114283251-114283273 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1047699208 8:127433001-127433023 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1047754749 8:127909836-127909858 CAACTGGAGTGGAGGGTTGTGGG + Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1049167926 8:141138333-141138355 AAGCAGGACTGAAGGCTTAATGG - Intronic
1050474010 9:6021209-6021231 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1050625576 9:7500610-7500632 AAGCAGCCCTGGAGAGATGTCGG - Intergenic
1052245689 9:26331140-26331162 AGGCATGACTGGAAGCTTGTAGG + Intergenic
1052323498 9:27193158-27193180 AAGCAGGACTGGGAGGTGGAGGG - Intronic
1052849250 9:33366464-33366486 AAGCAAGCCTGGAGGGGTTTGGG - Intronic
1052996414 9:34553726-34553748 AGGCTGGCCTGGAGGGTTGGGGG - Intronic
1053802765 9:41774702-41774724 GATCAGGACTGGAAGGATGTGGG + Intergenic
1054142479 9:61540368-61540390 GATCAGGACTGGAAGGATGTGGG - Intergenic
1054191068 9:61986048-61986070 GATCAGGACTGGAAGGATGTGGG + Intergenic
1054462223 9:65471518-65471540 GATCAGGACTGGAAGGATGTGGG - Intergenic
1054647300 9:67601669-67601691 GATCAGGACTGGAAGGATGTGGG - Intergenic
1055232914 9:74086926-74086948 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1055809905 9:80138679-80138701 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056044888 9:82705147-82705169 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1056061017 9:82885042-82885064 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056260058 9:84839978-84840000 AAGGAGGAAGGGAGGGATGTTGG - Intronic
1056323737 9:85459905-85459927 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1056781384 9:89553689-89553711 AAGCAGGAGTGCAGGGCTGGAGG - Intergenic
1057812732 9:98270297-98270319 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1058026359 9:100145155-100145177 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1059949212 9:119444474-119444496 AACCAGGGCTGGAGGGATGAGGG + Intergenic
1060102853 9:120855992-120856014 AAGCAGGCCTAGAAGGTTGCTGG + Exonic
1060225994 9:121791227-121791249 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1062267701 9:135694964-135694986 AAGCAGGACTGGGAGGAGGTGGG + Intronic
1185549728 X:973307-973329 AAGCTGGACTGGCGTGTTCTCGG + Intergenic
1187086671 X:16049123-16049145 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1187103917 X:16221277-16221299 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1188201159 X:27293978-27294000 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1188301215 X:28506881-28506903 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1188353968 X:29166994-29167016 AAGCAGGACTGCACGGTGTTAGG - Intronic
1188552502 X:31378773-31378795 AAGGAGGAATGGAGGGTGGAAGG - Intronic
1188637570 X:32453071-32453093 AGGCAGGATTTGAGGGTGGTAGG - Intronic
1189032950 X:37468288-37468310 CAGCAAGACAGGAGTGTTGTAGG - Intronic
1189223335 X:39391698-39391720 CAGCAGGACTGGAGGCTTGCAGG - Intergenic
1189657089 X:43255827-43255849 AAGCAGGAGGGGAGGAGTGTGGG - Intergenic
1190803926 X:53817222-53817244 AAGCAGGATTGCTGGGTTATAGG + Intergenic
1190988618 X:55522782-55522804 AAGGAAGTCTGGAGGGCTGTAGG - Intergenic
1191014347 X:55792759-55792781 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1191220602 X:57984658-57984680 AAGCAGGAGTGGAGGCAGGTGGG - Intergenic
1191691587 X:63944687-63944709 AAGCAAGACTGAAAGGCTGTAGG + Intergenic
1192454439 X:71265434-71265456 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1193885787 X:86983065-86983087 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1194308681 X:92277481-92277503 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1194366957 X:93024193-93024215 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1194503133 X:94703269-94703291 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1195291315 X:103434015-103434037 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1196072936 X:111545177-111545199 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1196221125 X:113113160-113113182 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1196330676 X:114468023-114468045 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1196341865 X:114605752-114605774 AAGGAGGAATGGAGGGTGGAAGG + Intronic
1197064766 X:122223298-122223320 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1197352206 X:125393301-125393323 AAGGAGGAATGGAGGGTGGAAGG + Intergenic
1197932928 X:131713313-131713335 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1199576332 X:149316936-149316958 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1200675177 Y:6140449-6140471 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1200812663 Y:7501619-7501641 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1201936941 Y:19419842-19419864 AAGGAGGAATGGAGGGTGGAAGG - Intergenic
1202021150 Y:20466371-20466393 CAGCAGGACTGATGGGTTCTGGG - Intergenic
1202076709 Y:21043904-21043926 AAGGAGGAATGGAGGGTGGAAGG + Intergenic