ID: 959620837

View in Genome Browser
Species Human (GRCh38)
Location 3:108397232-108397254
Sequence ATGCTGAGATAGGTGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959620837_959620842 -5 Left 959620837 3:108397232-108397254 CCTGGCCCCACCTATCTCAGCAT 0: 1
1: 0
2: 2
3: 26
4: 227
Right 959620842 3:108397250-108397272 AGCATGATTTCTGATCCTTCTGG 0: 1
1: 2
2: 176
3: 8908
4: 14788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959620837 Original CRISPR ATGCTGAGATAGGTGGGGCC AGG (reversed) Intronic
900151334 1:1180463-1180485 ATGCTGCGAGGGGTGGGGGCGGG - Exonic
900184437 1:1326314-1326336 AAGCAGAGACAGGTGGGGCCGGG - Intronic
901220824 1:7582917-7582939 GTGCTGAGAGAGGACGGGCCAGG - Intronic
903323434 1:22555899-22555921 GTCATGAGATAGTTGGGGCCAGG - Intergenic
904936282 1:34131921-34131943 ATCATGAGCTAGCTGGGGCCAGG + Intronic
904938856 1:34150972-34150994 ATGCTGATAAAGGGGGGGCGGGG + Intronic
906099020 1:43244607-43244629 AGACTGAGATACTTGGGGCCAGG + Intronic
906302841 1:44696124-44696146 TTGCTGCCATAGTTGGGGCCAGG - Intronic
906674309 1:47682182-47682204 AGCCTGAGATAGTTGGGGCATGG - Intergenic
908932636 1:69335098-69335120 ATCATGAGATAGGAAGGGCCAGG - Intergenic
912739244 1:112178209-112178231 ATGCTGTGAAAGGTGGGGGCAGG - Intergenic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
915166950 1:153953286-153953308 ATGCTGGGAGGTGTGGGGCCTGG + Exonic
915480043 1:156178219-156178241 ATACTGAGAGAGATGTGGCCAGG - Intergenic
917596494 1:176534362-176534384 ATACTGAGAGAGGTCGGGACTGG - Intronic
917798557 1:178550400-178550422 ATTCTGAGAAAGGTGGGGAATGG + Intergenic
918232181 1:182546373-182546395 CTGTTGAGTTAGGTGTGGCCAGG - Intronic
920719559 1:208374595-208374617 ATGCTGAGATGTGTGGGGTTGGG + Intergenic
922812826 1:228427200-228427222 AGGCTGAGGTAAGAGGGGCCTGG - Intergenic
924258796 1:242209072-242209094 ATGCTGAAATAGGAGAAGCCAGG - Intronic
1062986622 10:1775078-1775100 GAGCAGAGAGAGGTGGGGCCAGG + Intergenic
1067342813 10:45418647-45418669 AGGCAGAGGTACGTGGGGCCTGG + Intronic
1067347316 10:45445906-45445928 ATGCTGAGCTGGGTGTGGACAGG - Exonic
1068030174 10:51697001-51697023 ATGCTCAGATGCTTGGGGCCTGG + Exonic
1069719350 10:70539706-70539728 ATGCGGTGGTAGGTGAGGCCAGG - Exonic
1070644234 10:78190411-78190433 ATGGTGAGACAGGTGGGACCAGG - Intergenic
1071832021 10:89381376-89381398 ATGCTGGGTGAGGTGGGGTCAGG - Intronic
1072813414 10:98481503-98481525 CTGCTGACATAGGTAGGACCGGG + Intronic
1073247849 10:102104404-102104426 CTGCTGAGCTAGGGAGGGCCTGG - Intergenic
1073247953 10:102105079-102105101 CTGCTGAGCTAGGGAGGGCCTGG - Intergenic
1075694254 10:124421756-124421778 AGGCTGAGATGGGTGGATCCAGG - Intergenic
1076420220 10:130326168-130326190 ATGCTGAGTGAGGAGGAGCCAGG - Intergenic
1077574241 11:3368237-3368259 ATGGTGACATAGGTGGACCCTGG + Intronic
1077677183 11:4205520-4205542 GTGCTGAGAAGGGTGAGGCCAGG - Intergenic
1078207867 11:9245922-9245944 ATGAAGAGATAGGTTGGGCATGG - Intronic
1079032262 11:16994502-16994524 CTGCGGACATAGGTGGGGGCTGG + Intronic
1079131987 11:17752152-17752174 ATGTTGAGCTTGGTGGAGCCTGG + Intronic
1080094992 11:28395442-28395464 ATCCTGAAATAGGTGGGGTGAGG - Intergenic
1080896134 11:36450071-36450093 ACACTGAGATGGGTGCGGCCAGG - Intronic
1081678038 11:44982381-44982403 ATGGTGAGCTATGTGGGGACTGG - Intergenic
1081715370 11:45246309-45246331 GTGCTGAGGGAGGTGGTGCCTGG - Intronic
1083184068 11:61007518-61007540 GAGCTGAGACCGGTGGGGCCTGG - Intronic
1083691338 11:64410620-64410642 ATCCTGAGATAGGCAGAGCCTGG - Intergenic
1083732197 11:64658548-64658570 TTGCTGAGAGAGGTGGGGACTGG - Intronic
1083907234 11:65681031-65681053 AGGCCGAGGTAGGTGGAGCCTGG - Intergenic
1085321417 11:75576399-75576421 AGGCAGAGATGGGAGGGGCCTGG - Intergenic
1086461656 11:87011803-87011825 ATGCAGAGTGAGGTGGGGCATGG + Intergenic
1087327930 11:96746477-96746499 ATGCTGATATGGGAGGGGTCAGG + Intergenic
1089213818 11:116823530-116823552 ATGCTGAGGTTGGTGGGGTGGGG - Intergenic
1089721316 11:120425531-120425553 AGGCTGAGATGGGTGAGCCCAGG - Intronic
1089853632 11:121521391-121521413 ATCCTGGGATAGTTGGGGCTTGG + Intronic
1090288282 11:125519221-125519243 ATGCTGAGAGAGTAGGGGCTTGG - Intergenic
1090642202 11:128739430-128739452 AGACTGAGATGGGTGGGGCAGGG - Intronic
1094147281 12:27244047-27244069 AGGCGGAGATGGGTGGGGCCGGG + Intronic
1095962260 12:47843182-47843204 ATTCTGAGAGACATGGGGCCAGG + Exonic
1096699345 12:53371829-53371851 ATGCTGAGCTGGGCCGGGCCGGG + Intergenic
1097090794 12:56502984-56503006 ATACTGAGATAAGTCGGGCGCGG - Intergenic
1098250897 12:68568625-68568647 ATGCAGAAATAGGCGGGGCGCGG - Intergenic
1099429899 12:82571152-82571174 AAGCTGTCATAGTTGGGGCCGGG + Intergenic
1103025756 12:117572432-117572454 ATCCCGAGATAGGTGGGGCCAGG + Intronic
1103993393 12:124814187-124814209 TTGCTGAGGTACGTGTGGCCTGG - Exonic
1104825843 12:131709143-131709165 ATCCTGAGATAGGGAGGGACTGG - Intergenic
1106571538 13:30932667-30932689 GCGCTGAGATAGCTGGAGCCAGG + Intergenic
1108271528 13:48764940-48764962 AAGCTAAGAAAGGTCGGGCCTGG + Intergenic
1108391523 13:49952247-49952269 ATGAAGAGATAGGTAGGGCAAGG + Intergenic
1112408598 13:99142875-99142897 ATGCTCAGATACTGGGGGCCAGG + Intergenic
1112900705 13:104353879-104353901 ATGCTGAGAGTGGTGGGGAAGGG + Intergenic
1113714677 13:112494478-112494500 GTGCTGAGAGCCGTGGGGCCTGG - Intronic
1116056475 14:39870591-39870613 ATGCTGAGAGAAGTGGGACAGGG + Intergenic
1117648028 14:57872948-57872970 ATGCTGTGATTGGTGGAGCAGGG - Intronic
1117896965 14:60497036-60497058 ATGGAGAGATAGGTAGGGACAGG - Intronic
1119738832 14:77000756-77000778 CTGCAGGGATAGGAGGGGCCCGG - Intergenic
1121529451 14:94641967-94641989 ATGCTGTGATGGGTGGGGCTAGG - Intergenic
1122668743 14:103353789-103353811 AAGCTGATATAGTTTGGGCCGGG + Intergenic
1202829218 14_GL000009v2_random:8170-8192 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1202900930 14_GL000194v1_random:38022-38044 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1125831580 15:42720539-42720561 ATCCTAGGATAGGTGGGGCCAGG - Exonic
1126411740 15:48379076-48379098 ATCCTGAGATAGGGAGGGACTGG + Intergenic
1127384581 15:58457013-58457035 ATGCTGACAAAGGAGGTGCCCGG - Intronic
1129207370 15:74045067-74045089 ATGCTGTGATGGGTGGGGCCTGG - Exonic
1129281639 15:74489725-74489747 ATGGAGAGATAGGAGGGTCCTGG + Intergenic
1130067112 15:80614025-80614047 ATGCTGACATAGCTGGAGGCTGG + Intergenic
1130871736 15:87977483-87977505 ATGCTGGGATGGATGGAGCCTGG + Intronic
1132589379 16:720024-720046 ACGCTGAGCTGGGTGGGGCTGGG + Intronic
1132729980 16:1356445-1356467 CTCCTGAGACAGGTGGGGGCTGG - Intronic
1132896195 16:2230473-2230495 ATGCTGTGGGAGGTGGGGCGGGG + Intronic
1134023875 16:10940481-10940503 ATGCTGAGATATGGTGGGCAAGG - Intronic
1137801235 16:51263881-51263903 ATGGGGAGATGGGTGGGGTCAGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139493908 16:67302265-67302287 CTGCTTAGAGAGGAGGGGCCCGG + Intronic
1140659716 16:77176535-77176557 ATACTGAGATAATTGTGGCCTGG + Intergenic
1142773410 17:2116485-2116507 AGGCTGAGGTGGGTGGGGTCAGG + Intronic
1145253076 17:21307109-21307131 ATGCTGAGAGGAGGGGGGCCTGG - Intronic
1152574076 17:81132568-81132590 AAGCCCAGATGGGTGGGGCCAGG - Intronic
1153264268 18:3253936-3253958 ATGGTGAAATTGATGGGGCCTGG - Exonic
1153610202 18:6877260-6877282 ATGCTGAGATGGGTGAGGAGCGG + Intronic
1153744868 18:8167372-8167394 ATGCTGAGAAGTGTGGAGCCTGG - Intronic
1155106811 18:22675101-22675123 ATCCTGAGATAGGAAGGGACTGG + Intergenic
1157598560 18:48878642-48878664 ATACTGAGAAAGGCGGAGCCAGG + Intergenic
1158795248 18:60838260-60838282 CTCCTGAAATAGGTGGGGCTTGG - Intergenic
1159442777 18:68502953-68502975 ATGCTGAGAGCCGTGGGCCCTGG - Intergenic
1160390618 18:78528656-78528678 ATTCTGAGAAGGGTGGAGCCGGG - Intergenic
1160438715 18:78871987-78872009 CTGCAGAGAAAGGTGGGGGCTGG - Intergenic
1163717292 19:18879734-18879756 TTGGTGAGGTGGGTGGGGCCTGG - Intronic
1163717366 19:18879976-18879998 CTGGTGAGATAGGTTGGGCCAGG - Intronic
1164809776 19:31147003-31147025 TTGCTGAGAGAATTGGGGCCGGG + Intergenic
1165449462 19:35873811-35873833 AGGCTGAGATAGGTGGGAAGGGG - Intronic
1165793829 19:38507288-38507310 AGGCTGAAAAGGGTGGGGCCCGG + Intronic
1165895022 19:39136300-39136322 CTGCTGGGAGAGGTGGAGCCAGG - Intronic
1166018221 19:39999865-39999887 TTGCTGAAATAGGTCGGGCATGG - Intronic
1166548462 19:43648948-43648970 AGGCTGAGATGGGCAGGGCCAGG + Exonic
1167258858 19:48446381-48446403 AAGCTGAGACAGGGGGCGCCTGG - Exonic
1167337855 19:48897601-48897623 ATCCTGAGACAGGAGGGACCTGG - Intronic
1168247313 19:55118906-55118928 ATGCTGGGATTGGTGGTCCCGGG + Intergenic
1202643478 1_KI270706v1_random:119619-119641 ATGCAGAGATAGATGTGGCCTGG - Intergenic
927249074 2:20981895-20981917 AGGCTGAGATGAGTGGGGCATGG + Intergenic
927356638 2:22181172-22181194 AGGATAAGATAGGTTGGGCCAGG + Intergenic
928134863 2:28680577-28680599 ATGCTGAGAAAACTGAGGCCTGG - Intergenic
928742019 2:34366015-34366037 AGGCAGAGATAAGTGTGGCCGGG - Intergenic
929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG + Intronic
931374515 2:61695231-61695253 ATTTTTAGATAGCTGGGGCCTGG - Intergenic
931436639 2:62253367-62253389 AGTTTGAGATAAGTGGGGCCGGG + Intergenic
932097564 2:68865078-68865100 TTGCTCAGAGAGGAGGGGCCTGG - Intergenic
934505860 2:94893078-94893100 ATGTAGAGATAGATGTGGCCTGG - Intergenic
934680929 2:96283520-96283542 CGGCAGAGGTAGGTGGGGCCTGG - Exonic
934953740 2:98598776-98598798 AGGCTGAGTTAGGAGGAGCCTGG + Intergenic
935822554 2:106908774-106908796 AGGCTGAGATAGATGGTCCCAGG - Intergenic
939264045 2:139849145-139849167 ATCCTGAGATAGGGGGTGACTGG + Intergenic
944232549 2:197410797-197410819 ATAATTACATAGGTGGGGCCTGG - Intronic
945009517 2:205446260-205446282 ATCCTGAGGGAGGTGGGGCAGGG + Intronic
945250410 2:207761277-207761299 TTGCAGAAATAGGTGGGCCCAGG - Intronic
945328681 2:208514574-208514596 ATGTTGAATGAGGTGGGGCCTGG - Intronic
946419658 2:219557699-219557721 GTACTGAGAGAAGTGGGGCCAGG + Intronic
946779797 2:223182261-223182283 AGGCTGAGATAGGTGAGTCAAGG + Intronic
946943798 2:224798394-224798416 ATGGCGAGTTGGGTGGGGCCGGG + Intronic
947588496 2:231371196-231371218 ATGCTGCTAGATGTGGGGCCAGG - Intronic
948058881 2:235029281-235029303 TGGCTGAGATGGGTGAGGCCAGG + Intronic
948200717 2:236128096-236128118 AAGCTGAGAGAGGAGGGTCCTGG - Exonic
1171893447 20:30738558-30738580 ATGCAGAGATATATGTGGCCTGG - Intergenic
1172397758 20:34621535-34621557 ATGCTGGGACAGGTGTGGACAGG + Intronic
1173852276 20:46226749-46226771 CTCCTGGGATAGGAGGGGCCTGG - Intronic
1174056731 20:47803277-47803299 ATTCTGAGATAGATGGGGTGGGG + Intergenic
1174943947 20:54964050-54964072 TTGGAGAGATAGGTAGGGCCAGG + Intergenic
1175101102 20:56579405-56579427 ATCCTGAAAGAGGTGGGGCCCGG + Intergenic
1176173064 20:63704913-63704935 ATGCTGTGCCATGTGGGGCCAGG - Intronic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1176608402 21:8853010-8853032 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1176620304 21:9052800-9052822 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1177860927 21:26453233-26453255 ATCCTGAGATAGGGAGGGACTGG + Intergenic
1177880618 21:26689986-26690008 ATTCTGAGATAGGGAGGGACTGG + Intergenic
1178380695 21:32105252-32105274 AAGCTGAGAAAGTTGGGACCTGG - Intergenic
1179421328 21:41239030-41239052 ACGCTGAGCAAGGTGAGGCCAGG - Intronic
1180358485 22:11862814-11862836 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1180379777 22:12129516-12129538 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1181119296 22:20654857-20654879 ATGCTGGGCTGGGAGGGGCCTGG - Intergenic
1181466719 22:23114388-23114410 TTGCTGGGAAGGGTGGGGCCGGG - Intronic
1183720249 22:39558057-39558079 ATGCCAAGGTAGGTGGGGGCTGG + Intergenic
1183867294 22:40713953-40713975 ATGCTGATTGAGGTGGGGCTTGG - Intergenic
1184375011 22:44106246-44106268 ATGCTGATGTAGGTGGTCCCAGG + Intronic
949851475 3:8425092-8425114 ATGCTGAGACCCATGGGGCCAGG + Intergenic
950151531 3:10691376-10691398 CTACTGAGGTATGTGGGGCCTGG - Intronic
952207830 3:31198198-31198220 ATACAGTGATAGGTGGGGCATGG - Intergenic
952642077 3:35609395-35609417 ATGGTGAGAAAGGAGGGGACTGG + Intergenic
953143375 3:40249905-40249927 ATGCTGAGCCAGGTGGCCCCGGG + Intronic
953746119 3:45575370-45575392 ATGCTGAGCTGGGTAGGGGCTGG - Intronic
953822052 3:46215278-46215300 AAGTTGAGTTAGGTAGGGCCTGG + Intronic
953929226 3:46997683-46997705 CTCCTGCGAAAGGTGGGGCCCGG + Exonic
954391262 3:50269233-50269255 CTGCTGAGATGGGGCGGGCCGGG + Exonic
954848954 3:53584021-53584043 GTCCTGATATAGGTGGGGTCTGG + Intronic
955903017 3:63777345-63777367 GTGCTGAGATAGGTGGGCATGGG - Intergenic
956177262 3:66484641-66484663 TGGCTGGGACAGGTGGGGCCAGG + Intronic
959620837 3:108397232-108397254 ATGCTGAGATAGGTGGGGCCAGG - Intronic
959719459 3:109470479-109470501 ATGCTGAAATGGGAAGGGCCAGG + Intergenic
960944242 3:122955170-122955192 ATGCTAAGCTAGGTGGAACCTGG + Intronic
961052373 3:123757719-123757741 ATGCTGGGAAAGGCTGGGCCTGG + Intronic
961332680 3:126152189-126152211 AGGCTGACAGAGGTGGGGACAGG + Intronic
962875778 3:139535211-139535233 TTGCTGGGAGAGGTGTGGCCAGG - Intronic
966642707 3:182208471-182208493 AAGCTGAGCTAGGAGGGGCTGGG + Intergenic
967603106 3:191413041-191413063 ATCCTGAGATATGGGGGGCTGGG - Intergenic
968121961 3:196132085-196132107 ATGCTGAGGCAGGTGGGCCCTGG + Intergenic
968742346 4:2337588-2337610 ATGCTGGGCAAGGTGGGGGCGGG + Intronic
971375376 4:26051732-26051754 ATGCTGGGAAAGCTGTGGCCAGG + Intergenic
978337890 4:107689257-107689279 AGACTGAGAATGGTGGGGCCAGG - Intronic
978429559 4:108619578-108619600 AAGCTGAGAAAGGCGGGGTCAGG - Intergenic
981865526 4:149413422-149413444 ACGCTGAGATAGGGTGGGCAGGG + Intergenic
981980456 4:150785202-150785224 ATGCTGAGTTAGTTCGGGGCGGG + Intronic
982688664 4:158523780-158523802 ATTCTCACTTAGGTGGGGCCTGG - Intronic
983662003 4:170138057-170138079 ATGCTGAGATAGGTTCAGCTGGG + Intergenic
1202770848 4_GL000008v2_random:205533-205555 ATGCAGAGATAGATGTGGCCTGG - Intergenic
987399956 5:17464444-17464466 ATACAGAAATAGGAGGGGCCAGG - Intergenic
988799474 5:34683061-34683083 ATGCTGAGACAGCTGGCACCTGG + Intronic
989402145 5:41019147-41019169 ATGTTGAGAAAGGTGGTGACAGG + Intronic
991950418 5:71941999-71942021 TTGCTGTGAAAAGTGGGGCCAGG - Intergenic
992396990 5:76377653-76377675 ATGGTGAGATAGGCCGGGCGCGG + Intergenic
993140841 5:84031190-84031212 ATTCTGAGATAGTTGGGGTTAGG + Intronic
993537840 5:89108804-89108826 AGGCTGAGAAAGGTGGGGAGGGG + Intergenic
998073722 5:139219148-139219170 ACCCAGAGATAGGTGGGTCCAGG - Intronic
998312533 5:141150103-141150125 AAGCTGAGATAGATGTGTCCGGG + Exonic
999303863 5:150507602-150507624 CAGCTGAGCTGGGTGGGGCCAGG + Intronic
999330432 5:150670411-150670433 ATGCTTCGAGAGGTGGGGCCTGG + Intronic
1001513259 5:172338167-172338189 ATGCTGTGATAGGAGGGATCAGG + Exonic
1002164425 5:177335757-177335779 ATGCTGAGAGAGGAGGCTCCTGG + Intronic
1002820905 6:723873-723895 AGGCTGAGACAGGGAGGGCCAGG - Intergenic
1002883570 6:1274130-1274152 ATGCTGAGATGGGGGTGGCTGGG - Intergenic
1003230934 6:4253223-4253245 ATGTTGAGAGAGGGTGGGCCAGG - Intergenic
1003821884 6:9907245-9907267 GTGCTGCGGGAGGTGGGGCCTGG - Intronic
1006088816 6:31615896-31615918 ATGCTGAGAGAGGCAGGCCCGGG - Intronic
1006256359 6:32835632-32835654 AGACTAAGACAGGTGGGGCCTGG - Exonic
1010203131 6:73299848-73299870 CTGCTGGGATAAGTGGGGGCGGG + Intronic
1015415985 6:132949085-132949107 ATGATGAGATAGCTGAGGGCAGG + Intergenic
1017168568 6:151433945-151433967 AGGCTGAGGTGGGTGGGGCGGGG - Intronic
1019684514 7:2373526-2373548 ATGCTGCGAAAGGTGCGGCCAGG - Intronic
1019692407 7:2423627-2423649 ATGCTGAGCTCTGTGGGTCCAGG + Intronic
1022867701 7:34439289-34439311 AGGCTGAGGTAGGTGAGGTCAGG + Intergenic
1023058596 7:36309279-36309301 AAGATGAGATAGGAGGGGGCTGG - Intergenic
1025198452 7:56948736-56948758 CGGCTGGGAGAGGTGGGGCCTGG - Intergenic
1026259682 7:68744233-68744255 ATCATCATATAGGTGGGGCCAGG - Intergenic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1028867926 7:95735386-95735408 AGGCTGAGAAAGGTGGGGTTGGG - Intergenic
1029900697 7:104036328-104036350 AGGCTGAGTTAGGAGGGTCCAGG - Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1032906845 7:136377957-136377979 GTGCTGAGGAAGATGGGGCCAGG - Intergenic
1036621373 8:10426237-10426259 ATGCTGTGTGAGCTGGGGCCCGG + Intronic
1039309884 8:36305841-36305863 CTGCTGAGATAGGCAAGGCCAGG + Intergenic
1039587347 8:38718362-38718384 ATGGTGAAGTGGGTGGGGCCAGG + Intergenic
1040355571 8:46614835-46614857 ATGCAGAGACAGATGTGGCCTGG - Intergenic
1043310824 8:78857361-78857383 AGGATGACATAGGTGGGCCCTGG + Intergenic
1044796868 8:95910185-95910207 ATTCAGAGATAGGAGGGACCAGG + Intergenic
1047107030 8:121743958-121743980 ATGCTGAGATTGGCCGGGCACGG + Intergenic
1048584866 8:135765899-135765921 AGGCTGAGAAAGGTGGGGAGGGG + Intergenic
1049224055 8:141441305-141441327 CTGATGAGATGGGTGGGGGCAGG - Intergenic
1049277248 8:141726047-141726069 ATGCAGAGTTAGGTGCAGCCAGG - Intergenic
1053468755 9:38330233-38330255 AAGCTGCAATAGCTGGGGCCGGG + Intergenic
1054355191 9:64054154-64054176 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1055728104 9:79253046-79253068 ATGAAGAGATAGGTGGTGCTGGG + Intergenic
1057066680 9:92059786-92059808 TTGCTGACATAGATGGGGCTGGG - Intronic
1057630803 9:96717582-96717604 ATGCTTATGTAGGTGGGGCACGG - Intergenic
1059794213 9:117673828-117673850 ATGGTGAAATAGGCTGGGCCAGG - Intergenic
1060924466 9:127446425-127446447 ATGCTGAGGTAGGAGGGTGCAGG - Intergenic
1061792948 9:133068148-133068170 CTGCTGAGGCAGGCGGGGCCTGG - Intronic
1061795554 9:133083932-133083954 CTGCTGAGGCAGGCGGGGCCTGG - Intronic
1062465657 9:136679883-136679905 ATTCTGAGAGGGGAGGGGCCAGG - Intronic
1203703801 Un_KI270742v1:18220-18242 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1203566594 Un_KI270744v1:96260-96282 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1186760078 X:12713952-12713974 ATGCATACATATGTGGGGCCAGG - Intronic
1186946362 X:14572636-14572658 ATGCTGACATAAGAGGGGCCGGG + Intronic
1190131756 X:47754338-47754360 TTGCTGAAATGGGTGGGGTCGGG + Intergenic
1190753312 X:53380605-53380627 ATCCTGAGGTAGGGCGGGCCTGG - Exonic
1190855316 X:54288538-54288560 GTGCTGAGAAATGTGGGGGCTGG + Intronic
1191222353 X:58003041-58003063 ATGCTGAGCTTGGTGGGGCAAGG + Intergenic
1194369140 X:93048790-93048812 ATGCTGAGTTAGGAGGGGAGTGG + Intergenic
1197106055 X:122717602-122717624 ATGCTAAGATTTGAGGGGCCAGG + Intergenic
1197451027 X:126618268-126618290 AGGCTGAGATAGGCTGAGCCCGG - Intergenic
1198528347 X:137524631-137524653 AAGCTTAGATAAGTGTGGCCAGG - Intergenic
1198642385 X:138770673-138770695 ATGCAGAGATGGATGGGGCATGG - Intronic
1200677346 Y:6165121-6165143 ATGCTGAGTTAGGAGGGGAGTGG + Intergenic