ID: 959625489

View in Genome Browser
Species Human (GRCh38)
Location 3:108445073-108445095
Sequence ATCTGGGGTTAGCAGTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959625489 Original CRISPR ATCTGGGGTTAGCAGTATTA TGG Intronic
900714878 1:4137908-4137930 AGCTGGGGTCAGCAGTAATACGG - Intergenic
901724171 1:11227580-11227602 ATCTGTGGTTGGTAGTAGTAGGG + Intronic
903518231 1:23927236-23927258 ATCTGGGCTGGGCAGGATTAAGG - Intergenic
909281389 1:73758914-73758936 ATCTGGTGTTAAGATTATTATGG + Intergenic
909452034 1:75808672-75808694 CTCTGGAGTTAGCATTATCATGG - Intronic
913349295 1:117840669-117840691 ATCTGGGTTTATGAGTGTTAGGG - Intergenic
914426392 1:147581025-147581047 ATCTGGTTTTAGAAGTATTTTGG + Intronic
914745739 1:150499820-150499842 AGCTGGGGTTAGCATTACTCGGG + Intronic
1065440609 10:25749967-25749989 AAGAGGGGTCAGCAGTATTAGGG + Intergenic
1065491641 10:26288283-26288305 AGCTGGAGTAAACAGTATTAAGG - Intronic
1071370520 10:84946568-84946590 TTCTGGGATTAGAACTATTACGG + Intergenic
1071577293 10:86738115-86738137 ATCTGGTTTTAGCAGTCTCAGGG - Intergenic
1071689688 10:87803780-87803802 ATTTGCGGTTCGCAGTACTATGG + Intronic
1073173599 10:101534889-101534911 ATCTGGGGATAGAACTATAAAGG + Exonic
1077909235 11:6559459-6559481 ATCTGGTCTTAGCTGTATCATGG - Intronic
1083943883 11:65913216-65913238 GTCTGGGGTTTGCAGTATGTGGG + Intergenic
1085697201 11:78715122-78715144 TTCTGGGGTTAGCAGTAAACAGG + Intronic
1086364866 11:86098785-86098807 ATTTGGGGTGAGGAGTATCATGG - Intergenic
1087304088 11:96468914-96468936 TTCTGGAGTTAGAAGTGTTAAGG + Intronic
1088108824 11:106237239-106237261 ATCTGGGCTTAGTAGTTTTTTGG + Intergenic
1088108913 11:106238307-106238329 ATCTGGGCTTAGCAGCTTTTTGG + Intergenic
1093567983 12:20631568-20631590 ATCTGGGTTCAGCATTTTTAGGG + Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1101858777 12:108465550-108465572 ATCTGGGGTCAGCAGCAGAATGG - Intergenic
1102649450 12:114428500-114428522 ATCTGGGGCCAGCAGTGTTTTGG - Intergenic
1109832766 13:67813528-67813550 ATCTGTGGTTATCAGTAATTTGG + Intergenic
1110077581 13:71268130-71268152 TTTTGGGGTTTGCAATATTAAGG - Intergenic
1110172363 13:72516980-72517002 ATCTGGGGTTAGATCAATTACGG + Intergenic
1112569675 13:100582377-100582399 ATCTGTGGTTGGCAGAATAATGG + Intronic
1112889761 13:104214448-104214470 ATCAGGAGTTTGCAGTATTTTGG + Intergenic
1130676414 15:85956217-85956239 ATCAGGGCTCAGCAGTATAAAGG - Intergenic
1133735708 16:8613878-8613900 ATTTGGGGTTGTCAGTATTCTGG - Intergenic
1133859860 16:9584372-9584394 ATCTGAGGTTAGCCCTGTTAGGG - Intergenic
1138841130 16:60508071-60508093 ACCTGGGGGCTGCAGTATTAGGG + Intergenic
1143999534 17:11040145-11040167 ATCTGGTGTCAGAAGTGTTATGG - Intergenic
1145247128 17:21276577-21276599 ATTTGGTGTTTACAGTATTATGG + Intergenic
1148616486 17:49004239-49004261 ATCTGGGGTTCCCAGGACTAAGG - Intronic
1150326631 17:64263152-64263174 ATCTTGGGTGAGCAGTCTCAGGG - Exonic
1153579578 18:6558663-6558685 TTCTGGGGTAAGCAGAATTGGGG + Intronic
1156705168 18:39872786-39872808 AAATGGGGATAGCAGAATTACGG - Intergenic
1162803313 19:13122999-13123021 ATGGGGGGTGAGCAGTATTGAGG + Intronic
925285732 2:2714442-2714464 ACCTGGGGATAGCAGTGTTGCGG + Intergenic
926781769 2:16479371-16479393 ATCTGAGGTTGGTAGCATTATGG - Intergenic
927448087 2:23183498-23183520 CTCTGGGCTTAGGAGAATTATGG - Intergenic
928829714 2:35465805-35465827 AGCAGGGGTCAGCAGTAATATGG + Intergenic
930431829 2:51287338-51287360 CTCTGTGGTTATCAGCATTATGG + Intergenic
930669965 2:54138299-54138321 ATTTAGTGTTAGCAGTCTTAAGG + Intronic
930779563 2:55210704-55210726 CTCTGGGGTTAGCTATAATAGGG - Intronic
934921060 2:98346125-98346147 ATCTGGGGTTTGAAGTTTAAAGG - Intronic
939235026 2:139480157-139480179 ATTTGGGGTTAGTGGTATGAAGG + Intergenic
943855519 2:192784920-192784942 TTCTGGGGTTAACAGTTTGAAGG - Intergenic
945655252 2:212615387-212615409 GTCTTAGGTTAGCAATATTATGG - Intergenic
946093761 2:217253795-217253817 ATCTGAGGCTAGGAGTGTTAGGG + Intergenic
949013308 2:241694628-241694650 ATCTAGGGTTGGCAGAAGTATGG + Intergenic
1173207776 20:41007999-41008021 ATCTGGGGTTCTGAGTAGTAAGG - Intergenic
1177055190 21:16293000-16293022 CTCTGAGGTTAGAAGGATTAAGG - Intergenic
1178722694 21:35023824-35023846 ATCTGTGGGTACCAGTTTTATGG + Intronic
949915716 3:8963105-8963127 AGCTGAGGTTGGCAGTCTTATGG - Intronic
951116366 3:18867427-18867449 ATTTGAGGTTGGAAGTATTATGG - Intergenic
951593951 3:24296992-24297014 AAATGGGGTTAGAAGTACTAGGG - Intronic
952142273 3:30493378-30493400 GGCTGGGGTTAGCAGCATTCAGG - Intergenic
952975178 3:38687884-38687906 ATCTGGGCTTAGCTGGATTCAGG - Intergenic
956075708 3:65502957-65502979 ATCTGGGATTACCTGTATCATGG - Intronic
957589539 3:82177717-82177739 ATCTTGTTTTAGCAGTATTTGGG + Intergenic
959625489 3:108445073-108445095 ATCTGGGGTTAGCAGTATTATGG + Intronic
960694396 3:120381914-120381936 GGCTGGGGATGGCAGTATTAAGG + Intergenic
963103882 3:141629130-141629152 ATTTGGGGATAGGAGTTTTAAGG + Intergenic
972354471 4:38267520-38267542 ACCTGGGGTTAGCAGCACCAGGG + Intergenic
979518303 4:121636673-121636695 ATTTAGGGTTTGCAGTATTTAGG - Intergenic
982507672 4:156240441-156240463 ATCTGGGCTTTGCAGGGTTAGGG - Intergenic
984703031 4:182830739-182830761 ATTTGGTGTTATCAGTATTCTGG - Intergenic
989776269 5:45211464-45211486 ATTTTGGGTTAGTAGTTTTATGG - Intergenic
991900071 5:71451990-71452012 AGCAGAGGCTAGCAGTATTAAGG - Intergenic
993427147 5:87780779-87780801 ATCTGAGGATAGCACTATTTTGG + Intergenic
994042193 5:95271600-95271622 ATCTGGGGTTGAAAGGATTAAGG + Intronic
994227019 5:97264806-97264828 ATCTAGAGTTAGAAGTTTTATGG - Intergenic
998963326 5:147510810-147510832 ATCTGGGGTTTGTTGTATGAGGG - Intergenic
999733365 5:154493023-154493045 ATTTGGGGTTAGAAAGATTATGG - Intergenic
1000225693 5:159259796-159259818 ACCTCGGGTTTGAAGTATTAGGG + Intergenic
1004310023 6:14537142-14537164 AAATGGGGGTGGCAGTATTAAGG - Intergenic
1004952106 6:20684678-20684700 ATTTGGTGTTAGCAGTGTTCTGG + Intronic
1005680668 6:28204711-28204733 ATTTTGTGTTAGCAGTATTCTGG - Intergenic
1010230676 6:73531933-73531955 TTATGGAGTTAGAAGTATTAAGG + Intergenic
1010802911 6:80198972-80198994 ATCTAGGCTTAGTAGTATCAAGG - Intronic
1012478885 6:99645958-99645980 ATCTGAGGTTAACAATAATATGG - Intergenic
1014857889 6:126425070-126425092 ATCTTGGGAAAGCAGTTTTATGG + Intergenic
1018474313 6:164124704-164124726 ATCTGGGGTGAGGAGTACTCTGG - Intergenic
1018481786 6:164198374-164198396 CTCTGTTGTTAGCAGTACTAAGG + Intergenic
1020377534 7:7504791-7504813 AGCTGGGGTTTGCAGTATGATGG - Intronic
1022153497 7:27634920-27634942 TTGAGGGGTTAGCAGTATTCTGG - Intronic
1022888526 7:34672242-34672264 ATCTGTGGTTTGCTATATTATGG + Intronic
1026863053 7:73806096-73806118 ATCAGGGGTTAGGAGGATTCTGG - Intronic
1028205595 7:88013064-88013086 ATCTGGGGATTCCAGTCTTAGGG - Intronic
1031162009 7:118179883-118179905 ATCAGAGGTTAGCAAGATTAGGG - Intergenic
1031175606 7:118344770-118344792 ATCTGGGGCTATCAGTATTTAGG + Intergenic
1032559042 7:132869218-132869240 ATTTGGGGATGGCAGTGTTAAGG - Intronic
1037943978 8:22975049-22975071 TTTTGGGGTCAGCAGTATTGGGG - Intronic
1038212854 8:25535997-25536019 ATCTGTGGGTAGCAGAATTGGGG - Intergenic
1041612510 8:59868591-59868613 CTCTGGGGGTTGCAGTCTTAGGG + Intergenic
1044875514 8:96661946-96661968 ATTTGGTGTTGTCAGTATTATGG + Intronic
1051887411 9:21908135-21908157 ATCAGTGGTTACCAGGATTAAGG - Intronic
1055612359 9:78035867-78035889 ATCCAGGGTTAGCAATATCAAGG + Intergenic
1056011069 9:82331177-82331199 GTTTGGGGATAGCACTATTATGG - Intergenic
1056753934 9:89370973-89370995 ATCTGGGGTGAGCTGTGTCAGGG + Intronic
1058058197 9:100470244-100470266 TTTTGGGGTCACCAGTATTAAGG + Intronic
1058348226 9:103990315-103990337 ACCTGGGGTTACCCATATTAAGG - Intergenic
1059764882 9:117374740-117374762 ACCTGGGGTTAACAGAAGTAAGG + Intronic
1187703769 X:21989406-21989428 ATCTGGACTTTGCAGGATTACGG + Intronic
1189775425 X:44466173-44466195 ATTTGGTGTTATCAGTATTTTGG + Intergenic
1191913239 X:66173843-66173865 ATCTAGGGGTAGCAGTGATATGG + Intronic
1194896426 X:99447066-99447088 ATTTGGTGTTATCAGTATTTTGG - Intergenic
1196664511 X:118302715-118302737 ATCTGGGGAAAGAAGTAGTATGG - Intergenic